Human CASP3/CPP32/CPP32B ORF/cDNA clone-Lentivirus plasmid (NM_032991.2)

Cat. No.: pGMLP005817
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CASP3/CPP32/CPP32B Lentiviral expression plasmid for CASP3 lentivirus packaging, CASP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CASP3/CPP32 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $508.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005817
Gene Name CASP3
Accession Number NM_032991.2
Gene ID 836
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 834 bp
Gene Alias CPP32,CPP32B,SCA-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATCATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGATTATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGAATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAACTTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATGCGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGCCATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATTCAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCACCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA
ORF Protein Sequence MENTENSVDSKSIKNLEPKIIHGSESMDSGISLDNSYKMDYPEMGLCIIINNKNFHKSTGMTSRSGTDVDAANLRETFRNLKYEVRNKNDLTREEIVELMRDVSKEDHSKRSSFVCVLLSHGEEGIIFGTNGPVDLKKITNFFRGDRCRSLTGKPKLFIIQACRGTELDCGIETDSGVDDDMACHKIPVEADFLYAYSTAPGYYSWRNSKDGSWFIQSLCAMLKQYADKLEFMHILTRVNRKVATEFESFSFDATFHAKKQIPCIVSMLTKELYFYH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57943-Ab Anti-CASP3 monoclonal antibody
    Target Antigen GM-Tg-g-T57943-Ag CASP3 protein
    ORF Viral Vector pGMLP005817 Human CASP3 Lentivirus plasmid
    ORF Viral Vector pGMAP000159 Human CASP3 Adenovirus plasmid
    ORF Viral Vector vGMLP005817 Human CASP3 Lentivirus particle
    ORF Viral Vector vGMAP000159 Human CASP3 Adenovirus particle


    Target information

    Target ID GM-T57943
    Target Name CASP3
    Gene ID 836, 12367, 694473, 25402, 493932, 403567, 408016, 100034083
    Gene Symbol and Synonyms A830040C14Rik,AC-3,CASP-3,CASP3,Caspase-3,CC3,CPP-32,CPP32,CPP32-beta,CPP32B,Lice,mldy,SCA-1,Yama
    Uniprot Accession P42574
    Uniprot Entry Name CASP3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease gastric carcinoma, gastric cancer
    Gene Ensembl ENSG00000164305
    Target Classification Not Available

    The protein encoded by this gene is a cysteine-aspartic acid protease that plays a central role in the execution-phase of cell apoptosis. The encoded protein cleaves and inactivates poly(ADP-ribose) polymerase while it cleaves and activates sterol regulatory element binding proteins as well as caspases 6, 7, and 9. This protein itself is processed by caspases 8, 9, and 10. It is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which is associated with neuronal death in Alzheimer's disease. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.