Human CASP3/CPP32/CPP32B ORF/cDNA clone-Lentivirus plasmid (NM_032991.2)
Cat. No.: pGMLP005817
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CASP3/CPP32/CPP32B Lentiviral expression plasmid for CASP3 lentivirus packaging, CASP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CASP3/CPP32 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005817 |
Gene Name | CASP3 |
Accession Number | NM_032991.2 |
Gene ID | 836 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 834 bp |
Gene Alias | CPP32,CPP32B,SCA-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATCATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGATTATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGAATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAACTTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATGCGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGCCATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATTCAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCACCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA |
ORF Protein Sequence | MENTENSVDSKSIKNLEPKIIHGSESMDSGISLDNSYKMDYPEMGLCIIINNKNFHKSTGMTSRSGTDVDAANLRETFRNLKYEVRNKNDLTREEIVELMRDVSKEDHSKRSSFVCVLLSHGEEGIIFGTNGPVDLKKITNFFRGDRCRSLTGKPKLFIIQACRGTELDCGIETDSGVDDDMACHKIPVEADFLYAYSTAPGYYSWRNSKDGSWFIQSLCAMLKQYADKLEFMHILTRVNRKVATEFESFSFDATFHAKKQIPCIVSMLTKELYFYH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T57943-Ab | Anti-CASP3 monoclonal antibody |
Target Antigen | GM-Tg-g-T57943-Ag | CASP3 protein |
ORF Viral Vector | pGMLP005817 | Human CASP3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000159 | Human CASP3 Adenovirus plasmid |
ORF Viral Vector | vGMLP005817 | Human CASP3 Lentivirus particle |
ORF Viral Vector | vGMAP000159 | Human CASP3 Adenovirus particle |
Target information
Target ID | GM-T57943 |
Target Name | CASP3 |
Gene ID | 836, 12367, 694473, 25402, 493932, 403567, 408016, 100034083 |
Gene Symbol and Synonyms | A830040C14Rik,AC-3,CASP-3,CASP3,Caspase-3,CC3,CPP-32,CPP32,CPP32-beta,CPP32B,Lice,mldy,SCA-1,Yama |
Uniprot Accession | P42574 |
Uniprot Entry Name | CASP3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | gastric carcinoma, gastric cancer |
Gene Ensembl | ENSG00000164305 |
Target Classification | Not Available |
The protein encoded by this gene is a cysteine-aspartic acid protease that plays a central role in the execution-phase of cell apoptosis. The encoded protein cleaves and inactivates poly(ADP-ribose) polymerase while it cleaves and activates sterol regulatory element binding proteins as well as caspases 6, 7, and 9. This protein itself is processed by caspases 8, 9, and 10. It is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which is associated with neuronal death in Alzheimer's disease. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.