Human RAD51/BRCC5/FANCR ORF/cDNA clone-Lentivirus plasmid (NM_002875)
                                                               Cat. No.: pGMLV000274
 
                                                               
                                                               Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human RAD51/BRCC5/FANCR Lentiviral expression plasmid for RAD51 lentivirus packaging, RAD51 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
                                                                            RAD51/BRCC5 products
                                                                            collection>>
(antibodies,
                                                                            antigen, VLP, mRNA, ORF viral vector, etc)
                                                                        
                                                                    
Product Description
| Catalog ID | pGMLV000274 | 
| Gene Name | RAD51 | 
| Accession Number | NM_002875 | 
| Gene ID | 5888 | 
| Species | Human | 
| Product Type | Lentivirus plasmid (overexpression) | 
| Insert Length | 1020 bp | 
| Gene Alias | BRCC5,FANCR,HRAD51,HsRad51,HsT16930,MRMV2,RAD51A,RECA | 
| Fluorescent Reporter | ZsGreen | 
| Mammalian Cell Selection | Puromyocin | 
| Fusion Tag | 3xflag (C-Terminal) | 
| Promoter | CMV | 
| Resistance | Amplicin | 
| ORF Nucleotide Sequence | ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTTGGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAATTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTAATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAATTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATACAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATTGACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTCTCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATTGTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGTGTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTGTATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA | 
| ORF Protein Sequence | MAMQMQLEANADTSVEEESFGPQPISRLEQCGINANDVKKLEEAGFHTVEAVAYAPKKELINIKGISEAKADKILAEAAKLVPMGFTTATEFHQRRSEIIQITTGSKELDKLLQGGIETGSITEMFGEFRTGKTQICHTLAVTCQLPIDRGGGEGKAMYIDTEGTFRPERLLAVAERYGLSGSDVLDNVAYARAFNTDHQTQLLYQASAMMVESRYALLIVDSATALYRTDYSGRGELSARQMHLARFLRMLLRLADEFGVAVVITNQVVAQVDGAAMFAADPKKPIGGNIIAHASTTRLYLRKGRGETRICKIYDSPCLPEAEAMFAINADGVGDAKD | 
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name | 
|---|---|---|
| Target Antibody | GM-Tg-g-T63083-Ab | Anti-RAD51 monoclonal antibody | 
| Target Antigen | GM-Tg-g-T63083-Ag | RAD51 protein | 
| ORF Viral Vector | pGMLV000274 | Human RAD51 Lentivirus plasmid | 
| ORF Viral Vector | vGMLV000274 | Human RAD51 Lentivirus particle | 
Target information
| Target ID | GM-T63083 | 
| Target Name | RAD51 | 
| Gene ID | 5888, 19361, 708579, 499870, 101089015, 403568, 514749, 100071340 | 
| Gene Symbol and Synonyms | BRCC5,CRAD51,FANCR,HRAD51,HsRad51,HsT16930,MRMV2,RAD51,RAD51A,RECA,RGD1563603 | 
| Uniprot Accession | Q06609 | 
| Uniprot Entry Name | RAD51_HUMAN | 
| Protein Sub-location | Introcelluar Protein | 
| Category | Therapeutics Target | 
| Disease | Cancer | 
| Gene Ensembl | ENSG00000051180 | 
| Target Classification | Tumor-associated antigen (TAA) | 
The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
 
                
                 
             
         
         
                                                            

 Datasheet
                                                                        Datasheet
                                                                    
