Human UBE2A/HHR6A/MRXS30 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003336.4)

Cat. No.: pGMPC000301
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UBE2A/HHR6A/MRXS30 Non-Viral expression plasmid (overexpression vector) for mouse UBE2A overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to UBE2A/HHR6A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000301
Gene Name UBE2A
Accession Number NM_003336.4
Gene ID 7319
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 459 bp
Gene Alias HHR6A,MRXS30,MRXSN,RAD6A,UBC2
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCACCCCGGCTCGGCGGCGCCTCATGCGGGACTTCAAGAGGTTGCAGGAGGATCCTCCAGCCGGAGTCAGCGGGGCTCCGTCCGAGAACAACATAATGGTGTGGAACGCGGTCATTTTCGGGCCTGAAGGGACCCCGTTTGAGGATGGAACATTTAAACTTACAATAGAATTCACTGAAGAATATCCAAATAAACCACCTACAGTTAGATTTGTCTCTAAGATGTTCCATCCAAATGTCTATGCAGATGGTAGTATATGTCTGGACATACTTCAGAACCGTTGGAGTCCAACCTATGATGTGTCTTCCATTCTAACATCCATACAGTCTCTGTTGGATGAACCCAATCCCAATAGTCCAGCAAACAGCCAGGCTGCTCAGCTGTACCAGGAGAACAAACGGGAATATGAAAAGCGTGTTTCTGCAATAGTAGAACAAAGCTGGCGTGATTGTTGA
ORF Protein Sequence MSTPARRRLMRDFKRLQEDPPAGVSGAPSENNIMVWNAVIFGPEGTPFEDGTFKLTIEFTEEYPNKPPTVRFVSKMFHPNVYADGSICLDILQNRWSPTYDVSSILTSIQSLLDEPNPNSPANSQAAQLYQENKREYEKRVSAIVEQSWRDC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2794-Ab Anti-UBE2A monoclonal antibody
    Target Antigen GM-Tg-g-IP2794-Ag UBE2A protein
    ORF Viral Vector pGMPC000301 Human UBE2A Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-IP2794
    Target Name UBE2A
    Gene ID 7319, 22209, 693716, 298317, 101083326, 492095, 282107, 100058679
    Gene Symbol and Synonyms BHR6A,HHR6A,HR6A,Mhr6a,MRXS30,MRXSN,RAD6A,UBC2,UBE2A
    Uniprot Accession P49459
    Uniprot Entry Name UBE2A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000077721
    Target Classification Not Available

    The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, ubiquitin-conjugating enzymes, and ubiquitin-protein ligases. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair, and may play a role in transcriptional regulation. Mutations in this gene are associated with cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.