Human SIRT2/SIR2/SIR2L ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_012237)

Cat. No.: pGMPC000307
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SIRT2/SIR2/SIR2L Non-Viral expression plasmid (overexpression vector) for mouse SIRT2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to SIRT2/SIR2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000307
Gene Name SIRT2
Accession Number NM_012237
Gene ID 22933
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1170 bp
Gene Alias SIR2,SIR2L,SIR2L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGAGCCAGACCCCTCTCACCCTCTGGAGACCCAGGCAGGGAAGGTGCAGGAGGCTCAGGACTCAGATTCAGACTCTGAGGGAGGAGCCGCTGGTGGAGAAGCAGACATGGACTTCCTGCGGAACTTATTCTCCCAGACGCTCAGCCTGGGCAGCCAGAAGGAGCGTCTGCTGGACGAGCTGACCTTGGAAGGGGTGGCCCGGTACATGCAGAGCGAACGCTGTCGCAGAGTCATCTGTTTGGTGGGAGCTGGAATCTCCACATCCGCAGGCATCCCCGACTTTCGCTCTCCATCCACCGGCCTCTATGACAACCTAGAGAAGTACCATCTTCCCTACCCAGAGGCCATCTTTGAGATCAGCTATTTCAAGAAACATCCGGAACCCTTCTTCGCCCTCGCCAAGGAACTCTATCCTGGGCAGTTCAAGCCAACCATCTGTCACTACTTCATGCGCCTGCTGAAGGACAAGGGGCTACTCCTGCGCTGCTACACGCAGAACATAGATACCCTGGAGCGAATAGCCGGGCTGGAACAGGAGGACTTGGTGGAGGCGCACGGCACCTTCTACACATCACACTGCGTCAGCGCCAGCTGCCGGCACGAATACCCGCTAAGCTGGATGAAAGAGAAGATCTTCTCTGAGGTGACGCCCAAGTGTGAAGACTGTCAGAGCCTGGTGAAGCCTGATATCGTCTTTTTTGGTGAGAGCCTCCCAGCGCGTTTCTTCTCCTGTATGCAGTCAGACTTCCTGAAGGTGGACCTCCTCCTGGTCATGGGTACCTCCTTGCAGGTGCAGCCCTTTGCCTCCCTCATCAGCAAGGCACCCCTCTCCACCCCTCGCCTGCTCATCAACAAGGAGAAAGCTGGCCAGTCGGACCCTTTCCTGGGGATGATTATGGGCCTCGGAGGAGGCATGGACTTTGACTCCAAGAAGGCCTACAGGGACGTGGCCTGGCTGGGTGAATGCGACCAGGGCTGCCTGGCCCTTGCTGAGCTCCTTGGATGGAAGAAGGAGCTGGAGGACCTTGTCCGGAGGGAGCACGCCAGCATAGATGCCCAGTCGGGGGCGGGGGTCCCCAACCCCAGCACTTCAGCTTCCCCCAAGAAGTCCCCGCCACCTGCCAAGGACGAGGCCAGGACAACAGAGAGGGAGAAACCCCAGTGA
ORF Protein Sequence MAEPDPSHPLETQAGKVQEAQDSDSDSEGGAAGGEADMDFLRNLFSQTLSLGSQKERLLDELTLEGVARYMQSERCRRVICLVGAGISTSAGIPDFRSPSTGLYDNLEKYHLPYPEAIFEISYFKKHPEPFFALAKELYPGQFKPTICHYFMRLLKDKGLLLRCYTQNIDTLERIAGLEQEDLVEAHGTFYTSHCVSASCRHEYPLSWMKEKIFSEVTPKCEDCQSLVKPDIVFFGESLPARFFSCMQSDFLKVDLLLVMGTSLQVQPFASLISKAPLSTPRLLINKEKAGQSDPFLGMIMGLGGGMDFDSKKAYRDVAWLGECDQGCLALAELLGWKKELEDLVRREHASIDAQSGAGVPNPSTSASPKKSPPPAKDEARTTEREKPQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T83904-Ab Anti-SIRT2 monoclonal antibody
    Target Antigen GM-Tg-g-T83904-Ag SIRT2 protein
    ORF Viral Vector pGMLP001425 Human SIRT2 Lentivirus plasmid
    ORF Viral Vector pGMPC000307 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000562 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001357 Human SIRT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001425 Human SIRT2 Lentivirus particle


    Target information

    Target ID GM-T83904
    Target Name SIRT2
    Gene ID 22933, 64383, 100425019, 361532, 101099513, 612558, 504463, 100146611
    Gene Symbol and Synonyms 5730427M03Rik,SIR2,SIR2L,SIR2L2,SIRT2
    Uniprot Accession Q8IXJ6
    Uniprot Entry Name SIR2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000068903
    Target Classification Not Available

    This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Several transcript variants are resulted from alternative splicing of this gene. [provided by RefSeq, Jul 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.