Human SSR1/TRAPA ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003144)

Cat. No.: pGMPC000674
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SSR1/TRAPA Non-Viral expression plasmid (overexpression vector) for mouse SSR1 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SSR1/TRAPA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000674
Gene Name SSR1
Accession Number NM_003144
Gene ID 6745
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 861 bp
Gene Alias TRAPA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGACTCCTCCCCCGCTTGCTGCTGCTTCTCTTACTCGTGTTCCCTGCCACTGTCTTGTTCCGAGGCGGCCCCAGAGGCTTGTTAGCAGTGGCACAAGATCTTACAGAGGATGAAGAAACAGTAGAAGATTCCATAATTGAGGATGAAGATGATGAAGCCGAGGTAGAAGAAGATGAACCCACAGATTTGGTAGAAGATAAAGAGGAAGAAGATGTGTCTGGTGAACCTGAAGCTTCACCGAGTGCAGATACAACTATACTGTTTGTAAAAGGAGAAGATTTTCCAGCAAATAACATTGTGAAGTTCCTGGTAGGCTTTACCAACAAGGGTACAGAAGATTTTATTGTTGAATCCTTAGATGCCTCATTCCGTTATCCTCAGGACTACCAGTTTTATATCCAGAATTTCACAGCTCTTCCTCTGAACACTGTAGTGCCACCCCAGAGACAGGCAACTTTTGAGTACTCTTTCATTCCTGCAGAGCCCATGGGCGGACGACCATTTGGTTTGGTCATCAATCTGAACTACAAAGATTTGAACGGCAATGTATTCCAAGATGCAGTCTTCAATCAAACAGTTACAGTTATTGAAAGAGAGGATGGGTTAGATGGAGAAACAATCTTTATGTATATGTTCCTTGCTGGTCTTGGGCTTCTGGTTATTGTTGGCCTTCATCAACTCCTAGAATCTAGAAAGCGTAAGAGACCCATACAGAAAGTAGAAATGGGTACATCAAGTCAGAATGATGTTGACATGAGTTGGATTCCTCAGGAAACATTGAATCAAATCAATAAAGCTTCACCAAGAAGGTTGCCCAGGAAACGGGCACAGAAGAGATCAGTGGGATCTGATGAGTAA
ORF Protein Sequence MRLLPRLLLLLLLVFPATVLFRGGPRGLLAVAQDLTEDEETVEDSIIEDEDDEAEVEEDEPTDLVEDKEEEDVSGEPEASPSADTTILFVKGEDFPANNIVKFLVGFTNKGTEDFIVESLDASFRYPQDYQFYIQNFTALPLNTVVPPQRQATFEYSFIPAEPMGGRPFGLVINLNYKDLNGNVFQDAVFNQTVTVIEREDGLDGETIFMYMFLAGLGLLVIVGLHQLLESRKRKRPIQKVEMGTSSQNDVDMSWIPQETLNQINKASPRRLPRKRAQKRSVGSDE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1824-Ab Anti-SSR1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1824-Ag SSR1 protein
    ORF Viral Vector pGMLP002194 Human SSR1 Lentivirus plasmid
    ORF Viral Vector pGMPC000674 Human SSR1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002194 Human SSR1 Lentivirus particle


    Target information

    Target ID GM-IP1824
    Target Name SSR1
    Gene ID 6745, 107513, 693818, 361233, 101099638, 403951, 529312, 100061378
    Gene Symbol and Synonyms 2510001K09Rik,6330400D04,Ac2-238,SSR,SSR1,TRAPA
    Uniprot Accession P43307
    Uniprot Entry Name SSRA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000124783
    Target Classification Not Available

    The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR consists of 2 subunits, a 34-kD glycoprotein encoded by this gene and a 22-kD glycoprotein. This gene generates several mRNA species as a result of complex alternative polyadenylation. This gene is unusual in that it utilizes arrays of polyA signal sequences that are mostly non-canonical. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.