Human STX16/SYN16 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001001433.3)

Cat. No.: pGMPC000694
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human STX16/SYN16 Non-Viral expression plasmid (overexpression vector) for mouse STX16 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to STX16/SYN16 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000694
Gene Name STX16
Accession Number NM_001001433.3
Gene ID 8675
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 978 bp
Gene Alias SYN16
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACCAGGCGTTTAACCGACGCTTTCTTGTTGTTGCGGAATAATTCCATCCAAAACCGGCAGCTGTTAGCCGAGCAAGTGAGTAGTCACATCACCTCCAGCCCTCTGCATTCACGTAGCATTGCTGCGGAGCTGGACGAGCTTGCTGATGACCGTATGGCACTGGTGTCAGGCATCAGCTTAGATCCAGAAGCAGCGATTGGTGTGACAAAACGGCCACCTCCTAAGTGGGTGGATGGAGTGGATGAAATTCAGTATGATGTTGGCCGGATTAAGCAGAAGATGAAAGAATTGGCCAGCCTTCATGACAAGCATTTAAACAGACCCACCCTGGATGACAGCAGCGAAGAGGAACATGCCATTGAGATAACTACCCAAGAGATCACTCAGCTCTTCCACAGGTGCCAGCGTGCCGTGCAGGCCCTGCCGAGCCGGGCCCGGGCCTGCTCCGAGCAGGAGGGGCGGCTGCTTGGGAACGTGGTGGCCTCGCTGGCGCAGGCCCTGCAGGAACTCTCCACCAGCTTCCGGCACGCACAGTCAGGCTACCTCAAACGCATGAAGAATCGAGAGGAAAGATCCCAGCATTTTTTCGACACATCAGTACCACTAATGGATGATGGAGACGATAACACTCTTTACCATCGGGGTTTTACAGAGGACCAGTTAGTTCTGGTGGAGCAGAACACACTGATGGTGGAAGAGCGGGAACGAGAGATTCGCCAGATTGTACAGTCCATTTCTGACCTGAATGAAATATTCAGGGACTTAGGGGCGATGATTGTAGAACAGGGTACAGTCCTTGACAGAATTGACTATAACGTTGAACAGTCCTGTATCAAAACTGAAGATGGTTTGAAACAGCTTCACAAGGCAGAACAGTATCAAAAGAAGAATCGGAAGATGCTTGTGATTTTAATATTATTTGTCATCATCATTGTGCTCATTGTTGTCCTCGTTGGCGTGAAGTCTCGATAA
ORF Protein Sequence MATRRLTDAFLLLRNNSIQNRQLLAEQVSSHITSSPLHSRSIAAELDELADDRMALVSGISLDPEAAIGVTKRPPPKWVDGVDEIQYDVGRIKQKMKELASLHDKHLNRPTLDDSSEEEHAIEITTQEITQLFHRCQRAVQALPSRARACSEQEGRLLGNVVASLAQALQELSTSFRHAQSGYLKRMKNREERSQHFFDTSVPLMDDGDDNTLYHRGFTEDQLVLVEQNTLMVEEREREIRQIVQSISDLNEIFRDLGAMIVEQGTVLDRIDYNVEQSCIKTEDGLKQLHKAEQYQKKNRKMLVILILFVIIIVLIVVLVGVKSR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1849-Ab Anti-STX16 monoclonal antibody
    Target Antigen GM-Tg-g-IP1849-Ag STX16 protein
    ORF Viral Vector pGMPC000694 Human STX16 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-IP1849
    Target Name STX16
    Gene ID 8675, 228960, 362283, 101088739, 100855649, 519624, 100050597
    Gene Symbol and Synonyms 4930401D03,5430410K23Rik,6330500A18Rik,STX16,SYN-16,SYN16
    Uniprot Accession O14662
    Uniprot Entry Name STX16_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000124222
    Target Classification Not Available

    This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.