Human MASP1/3MC1/CRARF ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001031849.3)

Cat. No.: pGMPC000885
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MASP1/3MC1/CRARF Non-Viral expression plasmid (overexpression vector) for mouse MASP1 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to MASP1/3MC1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000885
Gene Name MASP1
Accession Number NM_001031849.3
Gene ID 5648
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1143 bp
Gene Alias 3MC1,CRARF,CRARF1,MAP-1,MAP1,MAp44,MASP,MASP-3,MASP3,PRSS5,RaRF
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGTGGCTGCTTCTCTATTATGCTCTGTGCTTCTCCCTGTCAAAGGCTTCAGCCCACACCGTGGAGCTAAACAATATGTTTGGCCAGATCCAGTCGCCTGGTTATCCAGACTCCTATCCCAGTGATTCAGAGGTGACTTGGAATATCACTGTCCCAGATGGGTTTCGGATCAAGCTTTACTTCATGCACTTCAACTTGGAATCCTCCTACCTTTGTGAATATGACTATGTGAAGGTAGAAACTGAGGACCAGGTGCTGGCAACCTTCTGTGGCAGGGAGACCACAGACACAGAGCAGACTCCCGGCCAGGAGGTGGTCCTCTCCCCTGGCTCCTTCATGTCCATCACTTTCCGGTCAGATTTCTCCAATGAGGAGCGTTTCACAGGCTTTGATGCCCACTACATGGCTGTGGATGTGGACGAGTGCAAGGAGAGGGAGGACGAGGAGCTGTCCTGTGACCACTACTGCCACAACTACATTGGCGGCTACTACTGCTCCTGCCGCTTCGGCTACATCCTCCACACAGACAACAGGACCTGCCGAGTGGAGTGCAGTGACAACCTCTTCACTCAAAGGACTGGGGTGATCACCAGCCCTGACTTCCCAAACCCTTACCCCAAGAGCTCTGAATGCCTGTATACCATCGAGCTGGAGGAGGGTTTCATGGTCAACCTGCAGTTTGAGGACATATTTGACATTGAGGACCATCCTGAGGTGCCCTGCCCCTATGACTACATCAAGATCAAAGTTGGTCCAAAAGTTTTGGGGCCTTTCTGTGGAGAGAAAGCCCCAGAACCCATCAGCACCCAGAGCCACAGTGTCCTGATCCTGTTCCATAGTGACAACTCGGGAGAGAACCGGGGCTGGAGGCTCTCATACAGGGCTGCAGGAAATGAGTGCCCAGAGCTACAGCCTCCTGTCCATGGGAAAATCGAGCCCTCCCAAGCCAAGTATTTCTTCAAAGACCAAGTGCTCGTCAGCTGTGACACAGGCTACAAAGTGCTGAAGGATAATGTGGAGATGGACACATTCCAGATTGAGTGTCTGAAGGATGGGACGTGGAGTAACAAGATTCCCACCTGTAAAAAAAATGAAATCGATCTGGAGAGCGAACTCAAGTCAGAGCAAGTGACAGAGTGA
ORF Protein Sequence MRWLLLYYALCFSLSKASAHTVELNNMFGQIQSPGYPDSYPSDSEVTWNITVPDGFRIKLYFMHFNLESSYLCEYDYVKVETEDQVLATFCGRETTDTEQTPGQEVVLSPGSFMSITFRSDFSNEERFTGFDAHYMAVDVDECKEREDEELSCDHYCHNYIGGYYCSCRFGYILHTDNRTCRVECSDNLFTQRTGVITSPDFPNPYPKSSECLYTIELEEGFMVNLQFEDIFDIEDHPEVPCPYDYIKIKVGPKVLGPFCGEKAPEPISTQSHSVLILFHSDNSGENRGWRLSYRAAGNECPELQPPVHGKIEPSQAKYFFKDQVLVSCDTGYKVLKDNVEMDTFQIECLKDGTWSNKIPTCKKNEIDLESELKSEQVTE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1089-Ab Anti-MASP1/ 3MC1/ CRARF functional antibody
    Target Antigen GM-Tg-g-SE1089-Ag MASP1 protein
    ORF Viral Vector pGMPC000391 Human MASP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000885 Human MASP1 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-SE1089
    Target Name MASP1
    Gene ID 5648, 17174, 708206, 64023, 101097166, 488121, 522347, 100068261
    Gene Symbol and Synonyms 3MC1,CCPII,CRARF,CRARF1,MAP-1,MAP1,MAp44,MASP,MASP-3,MASP1,Masp1/3,MASP3,PRSS5,RaRF,RPIB9
    Uniprot Accession P48740
    Uniprot Entry Name MASP1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000127241
    Target Classification Not Available

    This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.