Human LFNG/SCDO3 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001040167.2)

Cat. No.: pGMPC001155
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LFNG/SCDO3 Non-Viral expression plasmid (overexpression vector) for mouse LFNG overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to LFNG/SCDO3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001155
Gene Name LFNG
Accession Number NM_001040167.2
Gene ID 3955
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1140 bp
Gene Alias SCDO3
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCAAGCGCTGCGGCCGGCGCCTGCTGCTGGCGCTGGCGGGCGCGCTGCTCGCCTGCCTGCTGGTGCTCACCGCCGACCCGCCGCCGCCTCCACTGCCCGCCGAGCGCGGCCGGCGCGCGCTGCGCAGCCTGGCGGGCCCCGCGGGGGCTGCCCCGGCGCCCGGGCTGGGGGCGGCGGCGGCGGCGCCCGGGGCGCTGGTCCGCGACGTGCACAGTCTGTCCGAGTACTTCAGCCTGCTCACCCGCGCGCGCAGAGATGCGGGCCCGCCGCCCGGGGCTGCCCCCCGCCCCGCCGACGGCCACCCGCGCCCCCTGGCCGAGCCGCTCGCGCCCCGAGACGTCTTCATCGCTGTCAAGACCACCAAAAAGTTCCACCGCGCGCGCCTCGACCTGCTGCTGGAGACCTGGATCTCGCGCCACAAGGAGATGACGTTCATCTTCACTGACGGGGAAGATGAGGCCCTGGCCAGGCACACGGGCAACGTGGTCATCACAAACTGCTCGGCCGCCCACAGCCGCCAGGCGCTGTCCTGCAAGATGGCCGTGGAGTATGACCGCTTCATCGAGTCCGGCAGGAAGTGGTTCTGCCACGTGGACGATGACAACTACGTCAACCTGCGGGCCCTGCTGCGGCTGCTGGCCAGCTACCCGCACACGCGGGACGTCTACGTCGGCAAGCCCAGCCTGGACAGGCCCATCCAGGCCATGGAGCGGGTCAGCGAGAACAAGGTGCGTCCTGTCCACTTCTGGTTTGCCACGGGCGGCGCTGGCTTCTGCATCAGCCGTGGGCTGGCTCTGAAGATGAGCCCGTGGGCCAGCGGGGGTCACTTCATGAATACGGCTGAGCGGATCCGGCTGCCTGATGACTGCACCATCGGCTACATCGTGGAGGCCCTGCTGGGTGTGCCCCTCATCCGCAGCGGCCTCTTCCACTCCCACCTGGAGAACCTGCAGCAGGTGCCCACCTCGGAGCTCCACGAGCAGGTGACGCTGAGCTACGGTATGTTTGAAAACAAGCGGAACGCCGTCCACGTGAAGGGGCCCTTCTCGGTGGAGGCCGACCCATCCAGGTTCCGCTCCATCCACTGCCACCTGTACCCGGACACACCCTGGTGTCCCCGCACTGCCATCTTCTAG
ORF Protein Sequence MLKRCGRRLLLALAGALLACLLVLTADPPPPPLPAERGRRALRSLAGPAGAAPAPGLGAAAAAPGALVRDVHSLSEYFSLLTRARRDAGPPPGAAPRPADGHPRPLAEPLAPRDVFIAVKTTKKFHRARLDLLLETWISRHKEMTFIFTDGEDEALARHTGNVVITNCSAAHSRQALSCKMAVEYDRFIESGRKWFCHVDDDNYVNLRALLRLLASYPHTRDVYVGKPSLDRPIQAMERVSENKVRPVHFWFATGGAGFCISRGLALKMSPWASGGHFMNTAERIRLPDDCTIGYIVEALLGVPLIRSGLFHSHLENLQQVPTSELHEQVTLSYGMFENKRNAVHVKGPFSVEADPSRFRSIHCHLYPDTPWCPRTAIF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0308-Ab Anti-LFNG/ SCDO3 functional antibody
    Target Antigen GM-Tg-g-SE0308-Ag LFNG protein
    ORF Viral Vector pGMPC001155 Human LFNG Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-SE0308
    Target Name LFNG
    Gene ID 3955, 16848, 100428736, 170905, 101092320, 489891, 516209, 100147464
    Gene Symbol and Synonyms LFNG,SCDO3
    Uniprot Accession Q8NES3
    Uniprot Entry Name LFNG_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000106003
    Target Classification Not Available

    This gene is a member of the glycosyltransferase 31 gene family. Members of this gene family, which also includes the MFNG (GeneID: 4242) and RFNG (GeneID: 5986) genes, encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, these proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. The protein encoded by this gene is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. [provided by RefSeq, May 2018]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.