Human SMAD2/CHTD8/ hMAD-2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005901)
Pre-made Human SMAD2/CHTD8/ hMAD-2 Non-Viral expression plasmid (overexpression vector) for mouse SMAD2 overexpression in unique cell transient transfection and stable cell line development.
Go
to SMAD2/CHTD8 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC001202 | Human SMAD2 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC001202 |
Gene Name | SMAD2 |
Accession Number | NM_005901 |
Gene ID | 4087 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1404 bp |
Gene Alias | CHTD8, hMAD-2, hSMAD2, JV18, JV18-1, LDS6, MADH2, MADR2 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCGTCCATCTTGCCATTCACGCCGCCAGTTGTGAAGAGACTGCTGGGATGGAAGAAGTCAGCTGGTGGGTCTGGAGGAGCAGGCGGAGGAGAGCAGAATGGGCAGGAAGAAAAGTGGTGTGAGAAAGCAGTGAAAAGTCTGGTGAAGAAGCTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCAAAACTGTAATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAGATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGTATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCATCATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACCCTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCTAACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAATGACAAGAAGGCATATAGGAAGAGGAGTGCGCTTATACTACATAGGTGGGGAAGTTTTTGCTGAGTGCCTAAGTGATAGTGCAATCTTTGTGCAGAGCCCCAATTGTAATCAGAGATATGGCTGGCACCCTGCAACAGTGTGTAAAATTCCACCAGGCTGTAATCTGAAGATCTTCAACAACCAGGAATTTGCTGCTCTTCTGGCTCAGTCTGTTAATCAGGGTTTTGAAGCCGTCTATCAGCTAACTAGAATGTGCACCATAAGAATGAGTTTTGTGAAAGGGTGGGGAGCAGAATACCGAAGGCAGACGGTAACAAGTACTCCTTGCTGGATTGAACTTCATCTGAATGGACCTCTACAGTGGTTGGACAAAGTATTAACTCAGATGGGATCCCCTTCAGTGCGTTGCTCAAGCATGTCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1753-Ab | Anti-SMAD2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1753-Ag | SMAD2 protein |
Cytokine | cks-Tg-g-GM-IP1753 | SMAD family member 2 (SMAD2) protein & antibody |
ORF Viral Vector | pGMAD000190 | Human SMAD2 Adenovirus plasmid |
ORF Viral Vector | pGMPC001202 | Human SMAD2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP001353 | Human SMAD2 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-044 | Human SMAD2 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-184 | Human SMAD2 Adenovirus plasmid |
ORF Viral Vector | vGMAD000190 | Human SMAD2 Adenovirus particle |
ORF Viral Vector | vGMLP001353 | Human SMAD2 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-044 | Human SMAD2 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-184 | Human SMAD2 Adenovirus particle |
Target information
Target ID | GM-IP1753 |
Target Name | SMAD2 |
Gene ID | 4087, 17126, 697581, 29357, 101087179, 480144, 516010, 100033843 |
Gene Symbol and Synonyms | 7120426M23Rik,CHTD8,hMAD-2,hSMAD2,JV18,JV18-1,LDS6,MADH2,MADR2,mMad2,Smad-2,SMAD2 |
Uniprot Accession | Q15796 |
Uniprot Entry Name | SMAD2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000175387 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.