Human ERGIC1/AMC2/AMCN ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001031711)

Cat. No.: pGMPC001631
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ERGIC1/AMC2/AMCN Non-Viral expression plasmid (overexpression vector) for mouse ERGIC1 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ERGIC1/AMC2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001631
Gene Name ERGIC1
Accession Number NM_001031711
Gene ID 57222
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 873 bp
Gene Alias AMC2,AMCN,ERGIC-32,ERGIC32,NET24
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCTTTGACTTCAGGAGGTTTGACATCTACAGGAAGGTGCCCAAGGACCTTACGCAGCCAACGTACACCGGGGCCATTATCTCCATCTGCTGCTGCCTCTTCATCCTCTTCCTCTTCCTCTCGGAGCTCACCGGATTTATAACGACAGAAGTTGTGAACGAGCTCTATGTCGATGACCCAGACAAGGACAGCGGTGGCAAGATCGACGTCAGTCTGAACATCAGTTTACCCAATCTGCACTGCGAGTTGGTTGGGCTTGACATTCAGGATGAGATGGGCAGGCACGAAGTGGGCCACATCGACAACTCCATGAAGATCCCGCTGAACAATGGGGCAGGCTGCCGCTTCGAGGGGCAGTTCAGCATCAACAAGGTCCCCGGCAACTTCCACGTGTCCACACACAGTGCCACAGCCCAGCCACAGAACCCAGACATGACGCATGTCATCCACAAGCTCTCCTTTGGGGACACGCTACAGGTCCAGAACATCCACGGAGCTTTCAATGCTCTCGGGGGAGCAGACAGACTCACCTCCAACCCCCTGGCCTCCCACGACTACATCCTGAAGATTGTGCCCACGGTTTATGAGGACAAGAGTGGCAAGCAGCGGTACTCCTACCAGTACACGGTGGCCAACAAGGAATACGTCGCCTACAGCCACACGGGCCGCATCATCCCTGCAATCTGGTTCCGCTACGACCTCAGCCCCATCACGGTCAAGTACACAGAGAGACGGCAGCCGCTGTACAGATTCATCACCACGATCTGTGCCATCATTGGCGGGACCTTCACCGTCGCCGGCATCCTGGACTCATGCATCTTCACAGCCTCTGAGGCCTGGAAGAAGATCCAGCTGGGCAAGATGCATTGA
ORF Protein Sequence MPFDFRRFDIYRKVPKDLTQPTYTGAIISICCCLFILFLFLSELTGFITTEVVNELYVDDPDKDSGGKIDVSLNISLPNLHCELVGLDIQDEMGRHEVGHIDNSMKIPLNNGAGCRFEGQFSINKVPGNFHVSTHSATAQPQNPDMTHVIHKLSFGDTLQVQNIHGAFNALGGADRLTSNPLASHDYILKIVPTVYEDKSGKQRYSYQYTVANKEYVAYSHTGRIIPAIWFRYDLSPITVKYTERRQPLYRFITTICAIIGGTFTVAGILDSCIFTASEAWKKIQLGKMH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0764-Ab Anti-ERGIC1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0764-Ag ERGIC1 protein
    ORF Viral Vector pGMLP000579 Human ERGIC1 Lentivirus plasmid
    ORF Viral Vector pGMPC001631 Human ERGIC1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000579 Human ERGIC1 Lentivirus particle


    Target information

    Target ID GM-IP0764
    Target Name ERGIC1
    Gene ID 57222, 67458, 710623, 287177, 101093164, 609628, 616293, 100069822
    Gene Symbol and Synonyms 1200007D18Rik,AMC2,AMCN,ERGIC-32,ERGIC1,ERGIC32,maa-136,NET24
    Uniprot Accession Q969X5
    Uniprot Entry Name ERGI1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000113719
    Target Classification Not Available

    This gene encodes a cycling membrane protein which is an endoplasmic reticulum-golgi intermediate compartment (ERGIC) protein which interacts with other members of this protein family to increase their turnover. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.