Human EEF1D/EF-1D/EF1D ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001130055.4)

Cat. No.: pGMPC001768
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EEF1D/EF-1D/EF1D Non-Viral expression plasmid (overexpression vector) for mouse EEF1D overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to EEF1D/EF-1D products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001768
Gene Name EEF1D
Accession Number NM_001130055.4
Gene ID 1936
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 846 bp
Gene Alias EF-1D,EF1D,FP1047
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTACAAACTTCCTAGCACATGAGAAGATCTGGTTCGACAAGTTCAAATATGACGACGCAGAAAGGAGATTCTACGAGCAGATGAACGGGCCTGTGGCAGGTGCCTCCCGCCAGGAGAACGGCGCCAGCGTGATCCTCCGTGACATTGCGAGAGCCAGAGAGAACATCCAGAAATCCCTGGCTGGAAGCTCAGGCCCCGGGGCCTCCAGCGGCACCAGCGGAGACCACGGTGAGCTCGTCGTCCGGATTGCCAGTCTGGAAGTGGAGAACCAGAGTCTGCGTGGCGTGGTACAGGAGCTGCAGCAGGCCATCTCCAAGCTGGAGGCCCGGCTGAACGTGCTGGAGAAGAGCTCGCCTGGCCACCGGGCCACGGCCCCACAGACCCAGCACGTATCTCCCATGCGCCAAGTGGAGCCCCCAGCCAAGAAGCCAGCCACACCAGCAGAGGATGACGAGGATGATGACATTGACCTGTTTGGCAGTGACAATGAGGAGGAGGACAAGGAGGCGGCACAGCTGCGGGAGGAGCGGCTACGGCAGTACGCGGAGAAGAAGGCCAAGAAGCCTGCACTGGTGGCCAAGTCCTCCATCCTGCTGGATGTCAAGCCTTGGGATGATGAGACGGACATGGCCCAGCTGGAGGCCTGTGTGCGCTCTATCCAGCTGGACGGGCTGGTCTGGGGGGCTTCCAAGCTGGTGCCCGTGGGCTACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGGAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGGAGATCACCAAGTTTGAGGAGCACGTGCAGAGTGTCGATATCGCAGCTTTCAACAAGATCTGA
ORF Protein Sequence MATNFLAHEKIWFDKFKYDDAERRFYEQMNGPVAGASRQENGASVILRDIARARENIQKSLAGSSGPGASSGTSGDHGELVVRIASLEVENQSLRGVVQELQQAISKLEARLNVLEKSSPGHRATAPQTQHVSPMRQVEPPAKKPATPAEDDEDDDIDLFGSDNEEEDKEAAQLREERLRQYAEKKAKKPALVAKSSILLDVKPWDDETDMAQLEACVRSIQLDGLVWGASKLVPVGYGIRKLQIQCVVEDDKVGTDLLEEEITKFEEHVQSVDIAAFNKI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0739-Ab Anti-EEF1D monoclonal antibody
    Target Antigen GM-Tg-g-IP0739-Ag EEF1D protein
    ORF Viral Vector pGMLV002160 Human EEF1D Lentivirus plasmid
    ORF Viral Vector pGMPC001768 Human EEF1D Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002160 Human EEF1D Lentivirus particle


    Target information

    Target ID GM-IP0739
    Target Name EEF1D
    Gene ID 1936, 66656, 697625, 300033, 101098687, 475115, 516473, 100065805
    Gene Symbol and Synonyms EEF1D,EF-1-delta,EF-1D,EF1D,FP1047
    Uniprot Accession P29692
    Uniprot Entry Name EF1D_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000104529
    Target Classification Not Available

    This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.[provided by RefSeq, Aug 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.