Human CHEK2/CDS1/CHK2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_007194)

Cat. No.: pGMPC001827
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CHEK2/CDS1/CHK2 Non-Viral expression plasmid (overexpression vector) for mouse CHEK2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to RAD53/CHEK2/CDS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001827
Gene Name CHEK2
Accession Number NM_007194
Gene ID 11200
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1632 bp
Gene Alias CDS1,CHK2,hCds1,HuCds1,LFS2,PP1425,RAD53,TPDS4
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCTCGGGAGTCGGATGTTGAGGCTCAGCAGTCTCATGGCAGCAGTGCCTGTTCACAGCCCCATGGCAGCGTTACCCAGTCCCAAGGCTCCTCCTCACAGTCCCAGGGCATATCCAGCTCCTCTACCAGCACGATGCCAAACTCCAGCCAGTCCTCTCACTCCAGCTCTGGGACACTGAGCTCCTTAGAGACAGTGTCCACTCAGGAACTCTATTCTATTCCTGAGGACCAAGAACCTGAGGACCAAGAACCTGAGGAGCCTACCCCTGCCCCCTGGGCTCGATTATGGGCCCTTCAGGATGGATTTGCCAATCTTGAATGTGTGAATGACAACTACTGGTTTGGGAGGGACAAAAGCTGTGAATATTGCTTTGATGAACCACTGCTGAAAAGAACAGATAAATACCGAACATACAGCAAGAAACACTTTCGGATTTTCAGGGAAGTGGGTCCTAAAAACTCTTACATTGCATACATAGAAGATCACAGTGGCAATGGAACCTTTGTAAATACAGAGCTTGTAGGGAAAGGAAAACGCCGTCCTTTGAATAACAATTCTGAAATTGCACTGTCACTAAGCAGAAATAAAGTTTTTGTCTTTTTTGATCTGACTGTAGATGATCAGTCAGTTTATCCTAAGGCATTAAGAGATGAATACATCATGTCAAAAACTCTTGGAAGTGGTGCCTGTGGAGAGGTAAAGCTGGCTTTCGAGAGGAAAACATGTAAGAAAGTAGCCATAAAGATCATCAGCAAAAGGAAGTTTGCTATTGGTTCAGCAAGAGAGGCAGACCCAGCTCTCAATGTTGAAACAGAAATAGAAATTTTGAAAAAGCTAAATCATCCTTGCATCATCAAGATTAAAAACTTTTTTGATGCAGAAGATTATTATATTGTTTTGGAATTGATGGAAGGGGGAGAGCTGTTTGACAAAGTGGTGGGGAATAAACGCCTGAAAGAAGCTACCTGCAAGCTCTATTTTTACCAGATGCTCTTGGCTGTGCAGTACCTTCATGAAAACGGTATTATACACCGTGACTTAAAGCCAGAGAATGTTTTACTGTCATCTCAAGAAGAGGACTGTCTTATAAAGATTACTGATTTTGGGCACTCCAAGATTTTGGGAGAGACCTCTCTCATGAGAACCTTATGTGGAACCCCCACCTACTTGGCGCCTGAAGTTCTTGTTTCTGTTGGGACTGCTGGGTATAACCGTGCTGTGGACTGCTGGAGTTTAGGAGTTATTCTTTTTATCTGCCTTAGTGGGTATCCACCTTTCTCTGAGCATAGGACTCAAGTGTCACTGAAGGATCAGATCACCAGTGGAAAATACAACTTCATTCCTGAAGTCTGGGCAGAAGTCTCAGAGAAAGCTCTGGACCTTGTCAAGAAGTTGTTGGTAGTGGATCCAAAGGCACGTTTTACGACAGAAGAAGCCTTAAGACACCCGTGGCTTCAGGATGAAGACATGAAGAGAAAGTTTCAAGATCTTCTGTCTGAGGAAAATGAATCCACAGCTCTACCCCAGGTTCTAGCCCAGCCTTCTACTAGTCGAAAGCGGCCCCGTGAAGGGGAAGCCGAGGGTGCCGAGACCACAAAGCGCCCAGCTGTGTGTGCTGCTGTGTTGTGA
ORF Protein Sequence MSRESDVEAQQSHGSSACSQPHGSVTQSQGSSSQSQGISSSSTSTMPNSSQSSHSSSGTLSSLETVSTQELYSIPEDQEPEDQEPEEPTPAPWARLWALQDGFANLECVNDNYWFGRDKSCEYCFDEPLLKRTDKYRTYSKKHFRIFREVGPKNSYIAYIEDHSGNGTFVNTELVGKGKRRPLNNNSEIALSLSRNKVFVFFDLTVDDQSVYPKALRDEYIMSKTLGSGACGEVKLAFERKTCKKVAIKIISKRKFAIGSAREADPALNVETEIEILKKLNHPCIIKIKNFFDAEDYYIVLELMEGGELFDKVVGNKRLKEATCKLYFYQMLLAVQYLHENGIIHRDLKPENVLLSSQEEDCLIKITDFGHSKILGETSLMRTLCGTPTYLAPEVLVSVGTAGYNRAVDCWSLGVILFICLSGYPPFSEHRTQVSLKDQITSGKYNFIPEVWAEVSEKALDLVKKLLVVDPKARFTTEEALRHPWLQDEDMKRKFQDLLSEENESTALPQVLAQPSTSRKRPREGEAEGAETTKRPAVCAAVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0043-Ab Anti-RAD53 monoclonal antibody
    Target Antigen GM-Tg-g-IP0043-Ag RAD53/CHEK2 protein
    ORF Viral Vector pGMLP000677 Human CHEK2 Lentivirus plasmid
    ORF Viral Vector pGMLP005480 Human CHEK2 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-005 Human CHEK2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-145 Human CHEK2 Adenovirus plasmid
    ORF Viral Vector pGMPC001827 Human CHEK2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000677 Human CHEK2 Lentivirus particle
    ORF Viral Vector vGMLP005480 Human CHEK2 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-005 Human CHEK2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-145 Human CHEK2 Adenovirus particle


    Target information

    Target ID GM-IP0043
    Target Name RAD53
    Gene ID 11200, 50883, 713668, 114212, 101085665, 486338, 518897, 100059288
    Gene Symbol and Synonyms CDS1,CHEK2,CHK2,hCds1,HuCds1,LFS2,PP1425,RAD53
    Uniprot Accession O96017
    Uniprot Entry Name CHK2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000183765
    Target Classification Checkpoint-Immuno Oncology, Kinase, Tumor-associated antigen (TAA)

    In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.