Human MAPKAPK2/MAPKAP-K2/MK-2 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_032960.4)

Cat. No.: pGMPC004855
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPKAPK2/MAPKAP-K2/MK-2 Non-Viral expression plasmid (overexpression vector) for mouse MAPKAPK2 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MAPKAPK2/MAPKAP-K2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC004855
Gene Name MAPKAPK2
Accession Number NM_032960.4
Gene ID 9261
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1203 bp
Gene Alias MAPKAP-K2,MK-2,MK2
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGTCCAACTCCCAGGGCCAGAGCCCGCCGGTGCCGTTCCCCGCCCCGGCCCCGCCGCCGCAGCCCCCCACCCCTGCCCTGCCGCACCCCCCGGCGCAGCCGCCGCCGCCGCCCCCGCAGCAGTTCCCGCAGTTCCACGTCAAGTCCGGCCTGCAGATCAAGAAGAACGCCATCATCGATGACTACAAGGTCACCAGCCAGGTCCTGGGGCTGGGCATCAACGGCAAAGTTTTGCAGATCTTCAACAAGAGGACCCAGGAGAAATTCGCCCTCAAAATGCTTCAGGACTGCCCCAAGGCCCGCAGGGAGGTGGAGCTGCACTGGCGGGCCTCCCAGTGCCCGCACATCGTACGGATCGTGGATGTGTACGAGAATCTGTACGCAGGGAGGAAGTGCCTGCTGATTGTCATGGAATGTTTGGACGGTGGAGAACTCTTTAGCCGAATCCAGGATCGAGGAGACCAGGCATTCACAGAAAGAGAAGCATCCGAAATCATGAAGAGCATCGGTGAGGCCATCCAGTATCTGCATTCAATCAACATTGCCCATCGGGATGTCAAGCCTGAGAATCTCTTATACACCTCCAAAAGGCCCAACGCCATCCTGAAACTCACTGACTTTGGCTTTGCCAAGGAAACCACCAGCCACAACTCTTTGACCACTCCTTGTTATACACCGTACTATGTGGCTCCAGAAGTGCTGGGTCCAGAGAAGTATGACAAGTCCTGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTGCTGTGTGGGTATCCCCCCTTCTACTCCAACCACGGCCTTGCCATCTCTCCGGGCATGAAGACTCGCATCCGAATGGGCCAGTATGAATTTCCCAACCCAGAATGGTCAGAAGTATCAGAGGAAGTGAAGATGCTCATTCGGAATCTGCTGAAAACAGAGCCCACCCAGAGAATGACCATCACCGAGTTTATGAACCACCCTTGGATCATGCAATCAACAAAGGTCCCTCAAACCCCACTGCACACCAGCCGGGTCCTGAAGGAGGACAAGGAGCGGTGGGAGGATGTCAAGGAGGAGATGACCAGTGCCTTGGCCACAATGCGCGTTGACTACGAGCAGATCAAGATAAAAAAGATTGAAGATGCATCCAACCCTCTGCTGCTGAAGAGGCGGAAGAAAGCTCGGGCCCTGGAGGCTGCGGCTCTGGCCCACTGA
ORF Protein Sequence MLSNSQGQSPPVPFPAPAPPPQPPTPALPHPPAQPPPPPPQQFPQFHVKSGLQIKKNAIIDDYKVTSQVLGLGINGKVLQIFNKRTQEKFALKMLQDCPKARREVELHWRASQCPHIVRIVDVYENLYAGRKCLLIVMECLDGGELFSRIQDRGDQAFTEREASEIMKSIGEAIQYLHSINIAHRDVKPENLLYTSKRPNAILKLTDFGFAKETTSHNSLTTPCYTPYYVAPEVLGPEKYDKSCDMWSLGVIMYILLCGYPPFYSNHGLAISPGMKTRIRMGQYEFPNPEWSEVSEEVKMLIRNLLKTEPTQRMTITEFMNHPWIMQSTKVPQTPLHTSRVLKEDKERWEDVKEEMTSALATMRVDYEQIKIKKIEDASNPLLLKRRKKARALEAAALAH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0057-Ab Anti-MAPKAPK2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0057-Ag MAPKAPK2 protein
    ORF Viral Vector pGMPC004855 Human MAPKAPK2 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-IP0057
    Target Name MAPKAPK2
    Gene ID 9261, 17164, 695044, 289014, 101090833, 490263, 788091, 100055510
    Gene Symbol and Synonyms MAPKAP-K2,MAPKAPK2,MK-2,MK2,Rps6kc1
    Uniprot Accession P49137
    Uniprot Entry Name MAPK2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000162889
    Target Classification Kinase

    This gene encodes a member of the Ser/Thr protein kinase family. This kinase is regulated through direct phosphorylation by p38 MAP kinase. In conjunction with p38 MAP kinase, this kinase is known to be involved in many cellular processes including stress and inflammatory responses, nuclear export, gene expression regulation and cell proliferation. Heat shock protein HSP27 was shown to be one of the substrates of this kinase in vivo. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.