Human PPT1/CLN1/INCL ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_000310.4)

Cat. No.: pGMPC004874
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPT1/CLN1/INCL Non-Viral expression plasmid (overexpression vector) for mouse PPT1 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PPT1/CLN1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC004874
Gene Name PPT1
Accession Number NM_000310.4
Gene ID 5538
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 921 bp
Gene Alias CLN1,INCL,PPT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xHA (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGTCGCCCGGCTGCCTGTGGCTCTTGGCTGTGGCTCTCCTGCCATGGACCTGCGCTTCTCGGGCGCTGCAGCATCTGGACCCGCCGGCGCCGCTGCCGTTGGTGATCTGGCATGGGATGGGAGACAGCTGTTGCAATCCCTTAAGCATGGGTGCTATTAAAAAAATGGTGGAGAAGAAAATACCTGGAATTTACGTCTTATCTTTAGAGATTGGGAAGACCCTGATGGAGGACGTGGAGAACAGCTTCTTCTTGAATGTCAATTCCCAAGTAACAACAGTGTGTCAGGCACTTGCTAAGGATCCTAAATTGCAGCAAGGCTACAATGCTATGGGATTCTCCCAGGGAGGCCAATTTCTGAGGGCAGTGGCTCAGAGATGCCCTTCACCTCCCATGATCAATCTGATCTCGGTTGGGGGACAACATCAAGGTGTTTTTGGACTCCCTCGATGCCCAGGAGAGAGCTCTCACATCTGTGACTTCATCCGAAAAACACTGAATGCTGGGGCGTACTCCAAAGTTGTTCAGGAACGCCTCGTGCAAGCCGAATACTGGCATGACCCCATAAAGGAGGATGTGTATCGCAACCACAGCATCTTCTTGGCAGATATAAATCAGGAGCGGGGTATCAATGAGTCCTACAAGAAAAACCTGATGGCCCTGAAGAAGTTTGTGATGGTGAAATTCCTCAATGATTCCATTGTGGACCCTGTAGATTCGGAGTGGTTTGGATTTTACAGAAGTGGCCAAGCCAAGGAAACCATTCCCTTACAGGAGACCTCCCTGTACACACAGGACCGCCTGGGGCTAAAGGAAATGGACAATGCAGGACAGCTAGTGTTTCTGGCTACAGAAGGGGACCATCTTCAGTTGTCTGAAGAATGGTTTTATGCCCACATCATACCATTCCTTGGATGA
ORF Protein Sequence MASPGCLWLLAVALLPWTCASRALQHLDPPAPLPLVIWHGMGDSCCNPLSMGAIKKMVEKKIPGIYVLSLEIGKTLMEDVENSFFLNVNSQVTTVCQALAKDPKLQQGYNAMGFSQGGQFLRAVAQRCPSPPMINLISVGGQHQGVFGLPRCPGESSHICDFIRKTLNAGAYSKVVQERLVQAEYWHDPIKEDVYRNHSIFLADINQERGINESYKKNLMALKKFVMVKFLNDSIVDPVDSEWFGFYRSGQAKETIPLQETSLYTQDRLGLKEMDNAGQLVFLATEGDHLQLSEEWFYAHIIPFLG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97740-Ab Anti-PPT1/ CLN1/ INCL functional antibody
    Target Antigen GM-Tg-g-T97740-Ag PPT1 protein
    ORF Viral Vector pGMPC004874 Human PPT1 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-T97740
    Target Name PPT1
    Gene ID 5538, 19063, 693377, 29411, 101097408, 475316, 281421, 100068301
    Gene Symbol and Synonyms 9530043G02Rik,CLN1,D4Ertd184e,INCL,PPT,PPT1
    Uniprot Accession P50897
    Uniprot Entry Name PPT1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000131238
    Target Classification Not Available

    The protein encoded by this gene is a small glycoprotein involved in the catabolism of lipid-modified proteins during lysosomal degradation. The encoded enzyme removes thioester-linked fatty acyl groups such as palmitate from cysteine residues. Defects in this gene are a cause of infantile neuronal ceroid lipofuscinosis 1 (CLN1, or INCL) and neuronal ceroid lipofuscinosis 4 (CLN4). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.