Human PPT2/C6orf8/G14 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001204103.2)

Cat. No.: pGMPC004898
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPT2/C6orf8/G14 Non-Viral expression plasmid (overexpression vector) for mouse PPT2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to PPT2/C6orf8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC004898
Gene Name PPT2
Accession Number NM_001204103.2
Gene ID 9374
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 909 bp
Gene Alias C6orf8,G14,PPT-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xHA (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGGGCTCTGCGGGCAGCGGCTCCCCGCGGCGTGGGTCCTGCTTCTGTTGCCTTTCCTGCCGCTGCTGCTGCTTGCAGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCGTGGTGCATGGGCTCTTCGACAGCTCGTACAGCTTCCGCCACCTGCTGGAATACATCAATGAGACACACCCCGGGACTGTGGTGACAGTGCTCGATCTCTTCGATGGGAGAGAGAGCTTGCGACCCCTGTGGGAACAGGTGCAAGGGTTCCGAGAGGCTGTGGTCCCCATCATGGCAAAGGCCCCTCAAGGGGTGCATCTCATCTGCTACTCGCAGGGGGGCCTTGTGTGCCGGGCTCTGCTTTCTGTCATGGATGATCACAACGTGGATTCTTTCATCTCCCTCTCCTCTCCACAGATGGGACAGTATGGAGACACGGACTACTTGAAGTGGCTGTTCCCCACCTCCATGCGGTCTAACCTCTATCGGATCTGCTATAGCCCCTGGGGCCAGGAATTCTCCATCTGCAACTACTGGCATGATCCCCACCACGATGACTTGTACCTCAATGCCAGCAGCTTCCTGGCCCTGATCAATGGGGAAAGAGACCATCCCAATGCCACAGTATGGCGGAAGAACTTTCTGCGTGTGGGCCACCTGGTGCTGATTGGGGGCCCTGATGATGGTGTTATTACTCCCTGGCAGTCCAGCTTCTTTGGTTTCTATGATGCAAATGAGACCGTCCTGGAGATGGAGGAGCAACTGGTTTATCTGCGGGATTCTTTTGGGTTGAAGACTCTATTGGCCCGGGGGGCCATAGTGAGGTGTCCAATGGCCGGTATCTCCCACACAGCCTGGCACTCCAACCGTACCCTTTATGAGACCTGCATTGAACCTTGGCTCTCCTGA
ORF Protein Sequence MLGLCGQRLPAAWVLLLLPFLPLLLLAAPAPHRASYKPVIVVHGLFDSSYSFRHLLEYINETHPGTVVTVLDLFDGRESLRPLWEQVQGFREAVVPIMAKAPQGVHLICYSQGGLVCRALLSVMDDHNVDSFISLSSPQMGQYGDTDYLKWLFPTSMRSNLYRICYSPWGQEFSICNYWHDPHHDDLYLNASSFLALINGERDHPNATVWRKNFLRVGHLVLIGGPDDGVITPWQSSFFGFYDANETVLEMEEQLVYLRDSFGLKTLLARGAIVRCPMAGISHTAWHSNRTLYETCIEPWLS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0423-Ab Anti-PPT2/ C6orf8/ G14 functional antibody
    Target Antigen GM-Tg-g-SE0423-Ag PPT2 protein
    ORF Viral Vector pGMPC004898 Human PPT2 Mammalian (Non-Viral Vector) plasmid


    Target information

    Target ID GM-SE0423
    Target Name PPT2
    Gene ID 9374, 54397, 717212, 54398, 101095578, 474856, 516797
    Gene Symbol and Synonyms 0610007M19Rik,C6orf8,G14,PPT-2,PPT2
    Uniprot Accession Q9UMR5
    Uniprot Entry Name PPT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000221988
    Target Classification Not Available

    This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.