Human CYP2D6/CPD6/ CYP2D ORF/cDNA clone-Adenovirus particle (NM_000106)
Pre-made Human CYP2D6/CPD6/ CYP2D Adenovirus for CYP2D6 overexpression in-vitro and in-vivo. The CYP2D6 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CYP2D6-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CYP2D6/CPD6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000971 | Human CYP2D6 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000971 |
Gene Name | CYP2D6 |
Accession Number | NM_000106 |
Gene ID | 1565 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1494 bp |
Gene Alias | CPD6, CYP2D, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, CYP2DL1, CYPIID6, P450-DB1, P450C2D, P450DB1 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGCTAGAAGCACTGGTGCCCCTGGCCGTGATAGTGGCCATCTTCCTGCTCCTGGTGGACCTGATGCACCGGCGCCAACGCTGGGCTGCACGCTACCCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATGTGGACTTCCAGAACACACCATACTGCTTCGACCAGTTGCGGCGCCGCTTCGGGGACGTGTTCAGCCTGCAGCTGGCCTGGACGCCGGTGGTCGTGCTCAATGGGCTGGCGGCCGTGCGCGAGGCGCTGGTGACCCACGGCGAGGACACCGCCGACCGCCCGCCTGTGCCCATCACCCAGATCCTGGGTTTCGGGCCGCGTTCCCAAGGGGTGTTCCTGGCGCGCTATGGGCCCGCGTGGCGCGAGCAGAGGCGCTTCTCCGTGTCCACCTTGCGCAACTTGGGCCTGGGCAAGAAGTCGCTGGAGCAGTGGGTGACCGAGGAGGCCGCCTGCCTTTGTGCCGCCTTCGCCAACCACTCCGGACGCCCCTTTCGCCCCAACGGTCTCTTGGACAAAGCCGTGAGCAACGTGATCGCCTCCCTCACCTGCGGGCGCCGCTTCGAGTACGACGACCCTCGCTTCCTCAGGCTGCTGGACCTAGCTCAGGAGGGACTGAAGGAGGAGTCGGGCTTTCTGCGCGAGGTGCTGAATGCTGTCCCCGTCCTCCTGCATATCCCAGCGCTGGCTGGCAAGGTCCTACGCTTCCAAAAGGCTTTCCTGACCCAGCTGGATGAGCTGCTAACTGAGCACAGGATGACCTGGGACCCAGCCCAGCCCCCCCGAGACCTGACTGAGGCCTTCCTGGCAGAGATGGAGAAGGCCAAGGGGAACCCTGAGAGCAGCTTCAATGATGAGAACCTGCGCATAGTGGTGGCTGACCTGTTCTCTGCCGGGATGGTGACCACCTCGACCACGCTGGCCTGGGGCCTCCTGCTCATGATCCTACATCCGGATGTGCAGCGCCGTGTCCAACAGGAGATCGACGACGTGATAGGGCAGGTGCGGCGACCAGAGATGGGTGACCAGGCTCACATGCCCTACACCACTGCCGTGATTCATGAGGTGCAGCGCTTTGGGGACATCGTCCCCCTGGGTGTGACCCATATGACATCCCGTGACATCGAAGTACAGGGCTTCCGCATCCCTAAGGGAACGACACTCATCACCAACCTGTCATCGGTGCTGAAGGATGAGGCCGTCTGGGAGAAGCCCTTCCGCTTCCACCCCGAACACTTCCTGGATGCCCAGGGCCACTTTGTGAAGCCGGAGGCCTTCCTGCCTTTCTCAGCAGGCCGCCGTGCATGCCTCGGGGAGCCCCTGGCCCGCATGGAGCTCTTCCTCTTCTTCACCTCCCTGCTGCAGCACTTCAGCTTCTCGGTGCCCACTGGACAGCCCCGGCCCAGCCACCATGGTGTCTTTGCTTTCCTGGTGAGCCCATCCCCCTATGAGCTTTGTGCTGTGCCCCGCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0015-Ab | Anti-CYP2D6 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0015-Ag | CYP2D6 protein |
ORF Viral Vector | pGMAD000971 | Human CYP2D6 Adenovirus plasmid |
ORF Viral Vector | pGMLP002840 | Human CYP2D6 Lentivirus plasmid |
ORF Viral Vector | vGMAD000971 | Human CYP2D6 Adenovirus particle |
ORF Viral Vector | vGMLP002840 | Human CYP2D6 Lentivirus particle |
Target information
Target ID | GM-IP0015 |
Target Name | CYP2D6 |
Gene ID | 1565, 100500743, 415120 |
Gene Symbol and Synonyms | CPD6,CYP2D,CYP2D15,CYP2D6,CYP2D7AP,CYP2D7BP,CYP2D7P2,CYP2D8P2,CYP2DL1,CYPIID15,CYPIID6,P450-DB1,P450C2D,P450DB1 |
Uniprot Accession | P10635 |
Uniprot Entry Name | CP2D6_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000100197 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to metabolize as many as 25% of commonly prescribed drugs. Its substrates include antidepressants, antipsychotics, analgesics and antitussives, beta adrenergic blocking agents, antiarrythmics and antiemetics. The gene is highly polymorphic in the human population; certain alleles result in the poor metabolizer phenotype, characterized by a decreased ability to metabolize the enzyme's substrates. Some individuals with the poor metabolizer phenotype have no functional protein since they carry 2 null alleles whereas in other individuals the gene is absent. This gene can vary in copy number and individuals with the ultrarapid metabolizer phenotype can have 3 or more active copies of the gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.