Human FGF23/ADHR/ FGFN ORF/cDNA clone-Adenovirus particle (NM_020638.3)
Pre-made Human FGF23/ADHR/ FGFN Adenovirus for FGF23 overexpression in-vitro and in-vivo. The FGF23 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FGF23-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to FGF23/ADHR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD001005 | Human FGF23 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD001005 |
Gene Name | FGF23 |
Accession Number | NM_020638.3 |
Gene ID | 8074 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 756 bp |
Gene Alias | ADHR, FGFN, HFTC2, HPDR2, HYPF, PHPTC |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTGGGGGCCCGCCTCAGGCTCTGGGTCTGTGCCTTGTGCAGCGTCTGCAGCATGAGCGTCCTCAGAGCCTATCCCAATGCCTCCCCACTGCTCGGCTCCAGCTGGGGTGGCCTGATCCACCTGTACACAGCCACAGCCAGGAACAGCTACCACCTGCAGATCCACAAGAATGGCCATGTGGATGGCGCACCCCATCAGACCATCTACAGTGCCCTGATGATCAGATCAGAGGATGCTGGCTTTGTGGTGATTACAGGTGTGATGAGCAGAAGATACCTCTGCATGGATTTCAGAGGCAACATTTTTGGATCACACTATTTCGACCCGGAGAACTGCAGGTTCCAACACCAGACGCTGGAAAACGGGTACGACGTCTACCACTCTCCTCAGTATCACTTCCTGGTCAGTCTGGGCCGGGCGAAGAGAGCCTTCCTGCCAGGCATGAACCCACCCCCGTACTCCCAGTTCCTGTCCCGGAGGAACGAGATCCCCCTAATTCACTTCAACACCCCCATACCACGGCGGCACACCCGGAGCGCCGAGGACGACTCGGAGCGGGACCCCCTGAACGTGCTGAAGCCCCGGGCCCGGATGACCCCGGCCCCGGCCTCCTGTTCACAGGAGCTCCCGAGCGCCGAGGACAACAGCCCGATGGCCAGTGACCCATTAGGGGTGGTCAGGGGCGGTCGAGTGAACACGCACGCTGGGGGAACGGGCCCGGAAGGCTGCCGCCCCTTCGCCAAGTTCATCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-086 | Pre-Made Burosumab biosimilar, Whole mAb, Anti-FGF23 Antibody: Anti-ADHR/FGFN/HFTC2/HPDR2/HYPF/PHPTC therapeutic antibody |
Target Antibody | GM-Tg-g-T14853-Ab | Anti-FGF23/ ADHR/ FGFN functional antibody |
Target Antigen | GM-Tg-g-T14853-Ag | FGF23 protein |
Cytokine | cks-Tg-g-GM-T14853 | fibroblast growth factor 23 (FGF23) protein & antibody |
ORF Viral Vector | pGMAD000303 | Human FGF23 Adenovirus plasmid |
ORF Viral Vector | pGMAD001005 | Human FGF23 Adenovirus plasmid |
ORF Viral Vector | vGMAD000303 | Human FGF23 Adenovirus particle |
ORF Viral Vector | vGMAD001005 | Human FGF23 Adenovirus particle |
ORF Viral Vector | pGMLV002454 | Human FGF23 Lentivirus plasmid |
Target information
Target ID | GM-T14853 |
Target Name | FGF23 |
Gene ID | 8074, 64654, 710643, 170583, 101100063, 611773, 530239, 100058460 |
Gene Symbol and Synonyms | ADHR,FGF23,Fgf8b,FGFN,HFTC2,HPDR2,HYPF,PHPTC |
Uniprot Accession | Q9GZV9 |
Uniprot Entry Name | FGF23_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Hypertension, Localized osteoporosis [Lequesne] |
Gene Ensembl | ENSG00000118972 |
Target Classification | Not Available |
This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC). [provided by RefSeq, Feb 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.