Human FGF23/ADHR/ FGFN ORF/cDNA clone-Adenovirus particle (NM_020638.3)

Pre-made Human FGF23/ADHR/ FGFN Adenovirus for FGF23 overexpression in-vitro and in-vivo. The FGF23 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified FGF23-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to FGF23/ADHR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001005 Human FGF23 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001005
Gene Name FGF23
Accession Number NM_020638.3
Gene ID 8074
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 756 bp
Gene Alias ADHR, FGFN, HFTC2, HPDR2, HYPF, PHPTC
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGTTGGGGGCCCGCCTCAGGCTCTGGGTCTGTGCCTTGTGCAGCGTCTGCAGCATGAGCGTCCTCAGAGCCTATCCCAATGCCTCCCCACTGCTCGGCTCCAGCTGGGGTGGCCTGATCCACCTGTACACAGCCACAGCCAGGAACAGCTACCACCTGCAGATCCACAAGAATGGCCATGTGGATGGCGCACCCCATCAGACCATCTACAGTGCCCTGATGATCAGATCAGAGGATGCTGGCTTTGTGGTGATTACAGGTGTGATGAGCAGAAGATACCTCTGCATGGATTTCAGAGGCAACATTTTTGGATCACACTATTTCGACCCGGAGAACTGCAGGTTCCAACACCAGACGCTGGAAAACGGGTACGACGTCTACCACTCTCCTCAGTATCACTTCCTGGTCAGTCTGGGCCGGGCGAAGAGAGCCTTCCTGCCAGGCATGAACCCACCCCCGTACTCCCAGTTCCTGTCCCGGAGGAACGAGATCCCCCTAATTCACTTCAACACCCCCATACCACGGCGGCACACCCGGAGCGCCGAGGACGACTCGGAGCGGGACCCCCTGAACGTGCTGAAGCCCCGGGCCCGGATGACCCCGGCCCCGGCCTCCTGTTCACAGGAGCTCCCGAGCGCCGAGGACAACAGCCCGATGGCCAGTGACCCATTAGGGGTGGTCAGGGGCGGTCGAGTGAACACGCACGCTGGGGGAACGGGCCCGGAAGGCTGCCGCCCCTTCGCCAAGTTCATCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-086 Pre-Made Burosumab biosimilar, Whole mAb, Anti-FGF23 Antibody: Anti-ADHR/FGFN/HFTC2/HPDR2/HYPF/PHPTC therapeutic antibody
    Target Antibody GM-Tg-g-T14853-Ab Anti-FGF23/ ADHR/ FGFN functional antibody
    Target Antigen GM-Tg-g-T14853-Ag FGF23 protein
    Cytokine cks-Tg-g-GM-T14853 fibroblast growth factor 23 (FGF23) protein & antibody
    ORF Viral Vector pGMAD000303 Human FGF23 Adenovirus plasmid
    ORF Viral Vector pGMAD001005 Human FGF23 Adenovirus plasmid
    ORF Viral Vector vGMAD000303 Human FGF23 Adenovirus particle
    ORF Viral Vector vGMAD001005 Human FGF23 Adenovirus particle
    ORF Viral Vector pGMLV002454 Human FGF23 Lentivirus plasmid


    Target information

    Target ID GM-T14853
    Target Name FGF23
    Gene ID 8074, 64654, 710643, 170583, 101100063, 611773, 530239, 100058460
    Gene Symbol and Synonyms ADHR,FGF23,Fgf8b,FGFN,HFTC2,HPDR2,HYPF,PHPTC
    Uniprot Accession Q9GZV9
    Uniprot Entry Name FGF23_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Hypertension, Localized osteoporosis [Lequesne]
    Gene Ensembl ENSG00000118972
    Target Classification Not Available

    This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC). [provided by RefSeq, Feb 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.