Human DAPK2/DRP-1/DRP1 ORF/cDNA clone-Adenovirus particle (NM_014326.5)

Cat. No.: vGMAD001387

Pre-made Human DAPK2/DRP-1/DRP1 Adenovirus for DAPK2 overexpression in-vitro and in-vivo. The DAPK2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DAPK2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to DAPK2/DRP-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD001387 Human DAPK2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD001387
Gene Name DAPK2
Accession Number NM_014326.5
Gene ID 23604
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1113 bp
Gene Alias DRP-1,DRP1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGTTCCAGGCCTCAATGAGGAGTCCAAACATGGAGCCATTCAAGCAGCAGAAGGTGGAGGACTTTTATGACATCGGAGAGGAGCTGGGGAGTGGCCAGTTTGCCATCGTGAAGAAGTGCCGGGAGAAGAGCACGGGGCTTGAGTATGCAGCCAAGTTCATCAAGAAGCGGCAGAGCCGGGCGAGCCGGCGCGGTGTGAGCCGGGAGGAGATCGAGCGGGAGGTGAGCATCCTGCGGCAGGTGCTGCACCACAATGTCATCACGCTGCACGACGTCTATGAGAACCGCACCGACGTGGTGCTCATCCTTGAGCTAGTGTCTGGAGGAGAGCTCTTCGATTTCCTGGCCCAGAAGGAGTCACTGAGTGAGGAGGAGGCCACCAGCTTCATTAAGCAGATCCTGGATGGGGTGAACTACCTTCACACAAAGAAAATTGCTCACTTTGATCTCAAGCCAGAAAACATTATGTTGTTAGACAAGAATATTCCCATTCCACACATCAAGCTGATTGACTTTGGTCTGGCTCACGAAATAGAAGATGGAGTTGAATTTAAGAATATTTTTGGGACGCCGGAATTTGTTGCTCCAGAAATTGTGAACTACGAGCCCCTGGGTCTGGAGGCTGACATGTGGAGCATAGGCGTCATCACCTACATCCTCTTAAGTGGAGCATCCCCTTTCCTGGGAGACACGAAGCAGGAAACACTGGCAAATATCACAGCAGTGAGTTACGACTTTGATGAGGAATTCTTCAGCCAGACGAGCGAGCTGGCCAAGGACTTTATTCGGAAGCTTCTGGTTAAAGAGACCCGGAAACGGCTCACAATCCAAGAGGCTCTCAGACACCCCTGGATCACGCCGGTGGACAACCAGCAAGCCATGGTGCGCAGGGAGTCTGTGGTCAATCTGGAGAACTTCAGGAAGCAGTATGTCCGCAGGCGGTGGAAGCTTTCCTTCAGCATCGTGTCCCTGTGCAACCACCTCACCCGCTCGCTGATGAAGAAGGTGCACCTGAGGCCGGATGAGGACCTGAGGAACTGTGAGAGTGACACTGAGGAGGACATCGCCAGGAGGAAAGCCCTCCACCCACGGAGGAGGAGCAGCACCTCCTAA
ORF Protein Sequence MFQASMRSPNMEPFKQQKVEDFYDIGEELGSGQFAIVKKCREKSTGLEYAAKFIKKRQSRASRRGVSREEIEREVSILRQVLHHNVITLHDVYENRTDVVLILELVSGGELFDFLAQKESLSEEEATSFIKQILDGVNYLHTKKIAHFDLKPENIMLLDKNIPIPHIKLIDFGLAHEIEDGVEFKNIFGTPEFVAPEIVNYEPLGLEADMWSIGVITYILLSGASPFLGDTKQETLANITAVSYDFDEEFFSQTSELAKDFIRKLLVKETRKRLTIQEALRHPWITPVDNQQAMVRRESVVNLENFRKQYVRRRWKLSFSIVSLCNHLTRSLMKKVHLRPDEDLRNCESDTEEDIARRKALHPRRRSSTS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0665-Ab Anti-DAPK2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0665-Ag DAPK2 protein
    ORF Viral Vector pGMLP000235 Human DAPK2 Lentivirus plasmid
    ORF Viral Vector pGMLP005207 Human DAPK2 Lentivirus plasmid
    ORF Viral Vector pGMAD001387 Human DAPK2 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-145 Human DAPK2 Lentivirus plasmid
    ORF Viral Vector pGMPC001619 Human DAPK2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000235 Human DAPK2 Lentivirus particle
    ORF Viral Vector vGMLP005207 Human DAPK2 Lentivirus particle
    ORF Viral Vector vGMAD001387 Human DAPK2 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-145 Human DAPK2 Lentivirus particle


    Target information

    Target ID GM-IP0665
    Target Name DAPK2
    Gene ID 23604, 13143, 706421, 300799, 101089774, 610682, 529131, 100066921
    Gene Symbol and Synonyms DAPK2,DRP-1,DRP1
    Uniprot Accession Q9UIK4
    Uniprot Entry Name DAPK2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000035664
    Target Classification Kinase, Tumor-associated antigen (TAA)

    This gene encodes a protein that belongs to the serine/threonine protein kinase family. This protein contains a N-terminal protein kinase domain followed by a conserved calmodulin-binding domain with significant similarity to that of death-associated protein kinase 1 (DAPK1), a positive regulator of programmed cell death. Overexpression of this gene was shown to induce cell apoptosis.  It uses multiple polyadenylation sites. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.