Human CXCL6/CKA-3/ GCP-2 ORF/cDNA clone-Lentivirus particle (NM_002993)

Pre-made Human CXCL6/CKA-3/ GCP-2 Lentiviral expression plasmid for CXCL6 lentivirus packaging, CXCL6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CXCL6/CKA-3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002324 Human CXCL6 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002324
Gene Name CXCL6
Accession Number NM_002993
Gene ID 6372
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 345 bp
Gene Alias CKA-3, GCP-2, GCP2, SCYB6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCTCCCGTCCAGCCGCGCGGCCCGTGTCCCGGGTCCTTCGGGCTCCTTGTGCGCGCTGCTCGCGCTGCTGCTCCTGCTGACGCCGCCGGGGCCCCTCGCCAGCGCTGGTCCTGTCTCTGCTGTGCTGACAGAGCTGCGTTGCACTTGTTTACGCGTTACGCTGAGAGTAAACCCCAAAACGATTGGTAAACTGCAGGTGTTCCCCGCAGGCCCGCAGTGCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGCAAGTTTGTCTGGACCCGGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACAGTGGAAACAAGAAAAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0845-Ab Anti-CXCL6/ CKA-3/ GCP-2 functional antibody
    Target Antigen GM-Tg-g-SE0845-Ag CXCL6 protein
    Cytokine cks-Tg-g-GM-SE0845 chemokine (C-X-C motif) ligand 6 (CXCL6) protein & antibody
    ORF Viral Vector pGMLP002324 Human CXCL6 Lentivirus plasmid
    ORF Viral Vector vGMLP002324 Human CXCL6 Lentivirus particle


    Target information

    Target ID GM-SE0845
    Target Name CXCL6
    Gene ID 6372, 704133, 100033988
    Gene Symbol and Synonyms CKA-3,CXCL6,GCP-2,GCP2,SCYB6
    Uniprot Accession P80162
    Uniprot Entry Name CXCL6_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000124875
    Target Classification Not Available

    The protein encoded by this gene is a member CXC chemokine family. The encoded protein is a chemotactic for neutrophil granulocytes and has antibacterial action against gram-negative and gram-positive bacteria. This gene and other members of the CXC chemokine gene family form a gene cluster in a region of chromosome 4q. [provided by RefSeq, Jun 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.