Human CXCL5/ENA-78/ SCYB5 ORF/cDNA clone-Lentivirus particle (NM_002994)
Pre-made Human CXCL5/ENA-78/ SCYB5 Lentiviral expression plasmid for CXCL5 lentivirus packaging, CXCL5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CXCL5/ENA-78 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002668 | Human CXCL5 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002668 |
Gene Name | CXCL5 |
Accession Number | NM_002994 |
Gene ID | 6374 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 345 bp |
Gene Alias | ENA-78, SCYB5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCTCCTGTCCAGCCGCGCGGCCCGTGTCCCCGGTCCTTCGAGCTCCTTGTGCGCGCTGTTGGTGCTGCTGCTGCTGCTGACGCAGCCAGGGCCCATCGCCAGCGCTGGTCCTGCCGCTGCTGTGTTGAGAGAGCTGCGTTGCGTTTGTTTACAGACCACGCAAGGAGTTCATCCCAAAATGATCAGTAATCTGCAAGTGTTCGCCATAGGCCCACAGTGCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0844-Ab | Anti-CXCL5/ ENA-78/ SCYB5 functional antibody |
Target Antigen | GM-Tg-g-SE0844-Ag | CXCL5 protein |
Cytokine | cks-Tg-g-GM-SE0844 | chemokine (C-X-C motif) ligand 15 (CXCL15) protein & antibody |
ORF Viral Vector | pGMLP002668 | Human CXCL5 Lentivirus plasmid |
ORF Viral Vector | vGMLP002668 | Human CXCL5 Lentivirus particle |
Target information
Target ID | GM-SE0844 |
Target Name | CXCL5 |
Gene ID | 6374 |
Gene Symbol and Synonyms | CXCL5,ENA-78,SCYB5 |
Uniprot Accession | P42830 |
Uniprot Entry Name | CXCL5_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Prostate Cancer, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000163735 |
Target Classification | Not Available |
This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils, to promote angiogenesis and to remodel connective tissues. This protein is thought to play a role in cancer cell proliferation, migration, and invasion. [provided by RefSeq, May 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.