Human CXCL5/ENA-78/ SCYB5 ORF/cDNA clone-Lentivirus particle (NM_002994)

Pre-made Human CXCL5/ENA-78/ SCYB5 Lentiviral expression plasmid for CXCL5 lentivirus packaging, CXCL5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CXCL5/ENA-78 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002668 Human CXCL5 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002668
Gene Name CXCL5
Accession Number NM_002994
Gene ID 6374
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 345 bp
Gene Alias ENA-78, SCYB5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCTCCTGTCCAGCCGCGCGGCCCGTGTCCCCGGTCCTTCGAGCTCCTTGTGCGCGCTGTTGGTGCTGCTGCTGCTGCTGACGCAGCCAGGGCCCATCGCCAGCGCTGGTCCTGCCGCTGCTGTGTTGAGAGAGCTGCGTTGCGTTTGTTTACAGACCACGCAAGGAGTTCATCCCAAAATGATCAGTAATCTGCAAGTGTTCGCCATAGGCCCACAGTGCTCCAAGGTGGAAGTGGTAGCCTCCCTGAAGAACGGGAAGGAAATTTGTCTTGATCCAGAAGCCCCTTTTCTAAAGAAAGTCATCCAGAAAATTTTGGACGGTGGAAACAAGGAAAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0844-Ab Anti-CXCL5/ ENA-78/ SCYB5 functional antibody
    Target Antigen GM-Tg-g-SE0844-Ag CXCL5 protein
    Cytokine cks-Tg-g-GM-SE0844 chemokine (C-X-C motif) ligand 15 (CXCL15) protein & antibody
    ORF Viral Vector pGMLP002668 Human CXCL5 Lentivirus plasmid
    ORF Viral Vector vGMLP002668 Human CXCL5 Lentivirus particle


    Target information

    Target ID GM-SE0844
    Target Name CXCL5
    Gene ID 6374
    Gene Symbol and Synonyms CXCL5,ENA-78,SCYB5
    Uniprot Accession P42830
    Uniprot Entry Name CXCL5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Prostate Cancer, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000163735
    Target Classification Not Available

    This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils, to promote angiogenesis and to remodel connective tissues. This protein is thought to play a role in cancer cell proliferation, migration, and invasion. [provided by RefSeq, May 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.