Human AZGP1/ZA2G/ZAG ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001185.3)

Cat. No.: pGMAAV000018
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AZGP1/ZA2G/ZAG Adeno-associated virus expression plasmid (ITR-vector) for AZGP1 AAV packaging, AZGP1 AAV production.The purified Human AZGP1/ZA2G/ZAG AAV particle serves as an invaluable asset for in-depth in vivo AZGP1 studies, mechanism of action (MOA) research, and the evolution of AZGP1-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.


Target products collection

Go to AZGP1/ZA2G products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAAV000018
Gene Name AZGP1
Accession Number NM_001185.3
Gene ID 563
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 897 bp
Gene Alias ZA2G,ZAG
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTAAGAATGGTGCCTGTCCTGCTGTCTCTGCTGCTGCTTCTGGGTCCTGCTGTCCCCCAGGAGAACCAAGATGGTCGTTACTCTCTGACCTATATCTACACTGGGCTGTCCAAGCATGTTGAAGACGTCCCCGCGTTTCAGGCCCTTGGCTCACTCAATGACCTCCAGTTCTTTAGATACAACAGTAAAGACAGGAAGTCTCAGCCCATGGGACTCTGGAGACAGGTGGAAGGAATGGAGGATTGGAAGCAGGACAGCCAACTTCAGAAGGCCAGGGAGGACATCTTTATGGAGACCCTGAAAGACATCGTGGAGTATTACAACGACAGTAACGGGTCTCACGTATTGCAGGGAAGGTTTGGTTGTGAGATCGAGAATAACAGAAGCAGCGGAGCATTCTGGAAATATTACTATGATGGAAAGGACTACATTGAATTCAACAAAGAAATCCCAGCCTGGGTCCCCTTCGACCCAGCAGCCCAGATAACCAAGCAGAAGTGGGAGGCAGAACCAGTCTACGTGCAGCGGGCCAAGGCTTACCTGGAGGAGGAGTGCCCTGCGACTCTGCGGAAATACCTGAAATACAGCAAAAATATCCTGGACCGGCAAGATCCTCCCTCTGTGGTGGTCACCAGCCACCAGGCCCCAGGAGAAAAGAAGAAACTGAAGTGCCTGGCCTACGACTTCTACCCAGGGAAAATTGATGTGCACTGGACTCGGGCCGGCGAGGTGCAGGAGCCTGAGTTACGGGGAGATGTTCTTCACAATGGAAATGGCACTTACCAGTCCTGGGTGGTGGTGGCAGTGCCCCCGCAGGACACAGCCCCCTACTCCTGCCACGTGCAGCACAGCAGCCTGGCCCAGCCCCTCGTGGTGCCCTGGGAGGCCAGCTAG
ORF Protein Sequence MVRMVPVLLSLLLLLGPAVPQENQDGRYSLTYIYTGLSKHVEDVPAFQALGSLNDLQFFRYNSKDRKSQPMGLWRQVEGMEDWKQDSQLQKAREDIFMETLKDIVEYYNDSNGSHVLQGRFGCEIENNRSSGAFWKYYYDGKDYIEFNKEIPAWVPFDPAAQITKQKWEAEPVYVQRAKAYLEEECPATLRKYLKYSKNILDRQDPPSVVVTSHQAPGEKKKLKCLAYDFYPGKIDVHWTRAGEVQEPELRGDVLHNGNGTYQSWVVVAVPPQDTAPYSCHVQHSSLAQPLVVPWEAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T05249-Ab Anti-ZA2G/ AZGP1/ ZAG functional antibody
    Target Antigen GM-Tg-g-T05249-Ag AZGP1 protein
    ORF Viral Vector pGMAAV000018 Human AZGP1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMAAV000018 Human AZGP1 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T05249
    Target Name AZGP1
    Gene ID 563, 12007, 710136, 25294, 101097692, 479739, 508800, 100067197
    Gene Symbol and Synonyms AZGP1,ZA2G,ZA2GA,ZAG,Zna2gp
    Uniprot Accession P25311
    Uniprot Entry Name ZA2G_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000160862
    Target Classification Not Available

    Involved in cell adhesion and detection of chemical stimulus involved in sensory perception of bitter taste. Located in extracellular space. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.