Human LECT2/chm-II/chm2 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_002302.3)
Cat. No.: pGMAAV000594
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human LECT2/chm-II/chm2 Adeno-associated virus expression plasmid (ITR-vector) for LECT2 AAV packaging, LECT2 AAV production.The purified Human LECT2/chm-II/chm2 AAV particle serves as an invaluable asset for in-depth in vivo LECT2 studies, mechanism of action (MOA) research, and the evolution of LECT2-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go to
LECT2/chm-II products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAAV000594 |
Gene Name | LECT2 |
Accession Number | NM_002302.3 |
Gene ID | 3950 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 456 bp |
Gene Alias | chm-II,chm2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Null |
Fusion Tag | 6xHis (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTTTTCCACCAAAGCCCTCCTTTTGGCTGGTCTGATTTCTACCGCACTGGCAGGGCCATGGGCTAATATATGTGCTGGCAAGTCTTCCAATGAGATCCGGACGTGTGACCGCCATGGCTGTGGACAGTACTCTGCTCAAAGAAGTCAGAGGCCTCACCAGGGTGTGGACATCTTGTGCTCTGCTGGATCTACTGTGTACGCACCATTCACTGGAATGATTGTGGGCCAGGAGAAACCTTATCAAAACAAGAATGCTATCAATAATGGTGTTCGAATATCTGGAAGAGGTTTTTGTGTCAAAATGTTCTACATTAAGCCAATTAAGTATAAAGGTCCTATTAAGAAGGGAGAAAAACTTGGAACTCTATTGCCCTTGCAGAAAGTTTATCCTGGCATACAATCGCATGTGCACATTGAAAACTGTGACTCGAGTGACCCTACTGCATACCTGTAA |
ORF Protein Sequence | MFSTKALLLAGLISTALAGPWANICAGKSSNEIRTCDRHGCGQYSAQRSQRPHQGVDILCSAGSTVYAPFTGMIVGQEKPYQNKNAINNGVRISGRGFCVKMFYIKPIKYKGPIKKGEKLGTLLPLQKVYPGIQSHVHIENCDSSDPTAYL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1066-Ab | Anti-LECT2/ chm-II/ chm2 functional antibody |
Target Antigen | GM-Tg-g-SE1066-Ag | LECT2 protein |
ORF Viral Vector | pGMLP001961 | Human LECT2 Lentivirus plasmid |
ORF Viral Vector | pGMAD001364 | Human LECT2 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000594 | Human LECT2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLP001961 | Human LECT2 Lentivirus particle |
ORF Viral Vector | vGMAD001364 | Human LECT2 Adenovirus particle |
ORF Viral Vector | vGMAAV000594 | Human LECT2 Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-SE1066 |
Target Name | LECT2 |
Gene ID | 3950, 16841, 712424, 361205, 101081021, 474687, 281899, 100629369 |
Gene Symbol and Synonyms | chm-II,chm2,LECT2 |
Uniprot Accession | O14960 |
Uniprot Entry Name | LECT2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000145826 |
Target Classification | Not Available |
This gene encodes a secreted, 16 kDa protein that acts as a chemotactic factor to neutrophils and stimulates the growth of chondrocytes and osteoblasts. This protein has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein. A polymorphism in this gene may be associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.