Human LECT2/chm-II/chm2 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_002302.3)

Cat. No.: pGMAAV000594
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LECT2/chm-II/chm2 Adeno-associated virus expression plasmid (ITR-vector) for LECT2 AAV packaging, LECT2 AAV production.The purified Human LECT2/chm-II/chm2 AAV particle serves as an invaluable asset for in-depth in vivo LECT2 studies, mechanism of action (MOA) research, and the evolution of LECT2-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.


Target products collection

Go to LECT2/chm-II products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAAV000594
Gene Name LECT2
Accession Number NM_002302.3
Gene ID 3950
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 456 bp
Gene Alias chm-II,chm2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 6xHis (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTTCCACCAAAGCCCTCCTTTTGGCTGGTCTGATTTCTACCGCACTGGCAGGGCCATGGGCTAATATATGTGCTGGCAAGTCTTCCAATGAGATCCGGACGTGTGACCGCCATGGCTGTGGACAGTACTCTGCTCAAAGAAGTCAGAGGCCTCACCAGGGTGTGGACATCTTGTGCTCTGCTGGATCTACTGTGTACGCACCATTCACTGGAATGATTGTGGGCCAGGAGAAACCTTATCAAAACAAGAATGCTATCAATAATGGTGTTCGAATATCTGGAAGAGGTTTTTGTGTCAAAATGTTCTACATTAAGCCAATTAAGTATAAAGGTCCTATTAAGAAGGGAGAAAAACTTGGAACTCTATTGCCCTTGCAGAAAGTTTATCCTGGCATACAATCGCATGTGCACATTGAAAACTGTGACTCGAGTGACCCTACTGCATACCTGTAA
ORF Protein Sequence MFSTKALLLAGLISTALAGPWANICAGKSSNEIRTCDRHGCGQYSAQRSQRPHQGVDILCSAGSTVYAPFTGMIVGQEKPYQNKNAINNGVRISGRGFCVKMFYIKPIKYKGPIKKGEKLGTLLPLQKVYPGIQSHVHIENCDSSDPTAYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1066-Ab Anti-LECT2/ chm-II/ chm2 functional antibody
    Target Antigen GM-Tg-g-SE1066-Ag LECT2 protein
    ORF Viral Vector pGMLP001961 Human LECT2 Lentivirus plasmid
    ORF Viral Vector pGMAD001364 Human LECT2 Adenovirus plasmid
    ORF Viral Vector pGMAAV000594 Human LECT2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP001961 Human LECT2 Lentivirus particle
    ORF Viral Vector vGMAD001364 Human LECT2 Adenovirus particle
    ORF Viral Vector vGMAAV000594 Human LECT2 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1066
    Target Name LECT2
    Gene ID 3950, 16841, 712424, 361205, 101081021, 474687, 281899, 100629369
    Gene Symbol and Synonyms chm-II,chm2,LECT2
    Uniprot Accession O14960
    Uniprot Entry Name LECT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000145826
    Target Classification Not Available

    This gene encodes a secreted, 16 kDa protein that acts as a chemotactic factor to neutrophils and stimulates the growth of chondrocytes and osteoblasts. This protein has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein. A polymorphism in this gene may be associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.