Human LECT2/chm-II/chm2 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_002302.3)

Cat. No.: vGMAAV000594

Pre-made Human LECT2/chm-II/chm2 Adeno-associated virus particle for LECT2 in-vivo study, mechanism of action (MOA) research and LECT2-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to LECT2/chm-II products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000594 Human LECT2 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000594
Gene Name LECT2
Accession Number NM_002302.3
Gene ID 3950
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 456 bp
Gene Alias chm-II,chm2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 6xHis (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTTCCACCAAAGCCCTCCTTTTGGCTGGTCTGATTTCTACCGCACTGGCAGGGCCATGGGCTAATATATGTGCTGGCAAGTCTTCCAATGAGATCCGGACGTGTGACCGCCATGGCTGTGGACAGTACTCTGCTCAAAGAAGTCAGAGGCCTCACCAGGGTGTGGACATCTTGTGCTCTGCTGGATCTACTGTGTACGCACCATTCACTGGAATGATTGTGGGCCAGGAGAAACCTTATCAAAACAAGAATGCTATCAATAATGGTGTTCGAATATCTGGAAGAGGTTTTTGTGTCAAAATGTTCTACATTAAGCCAATTAAGTATAAAGGTCCTATTAAGAAGGGAGAAAAACTTGGAACTCTATTGCCCTTGCAGAAAGTTTATCCTGGCATACAATCGCATGTGCACATTGAAAACTGTGACTCGAGTGACCCTACTGCATACCTGTAA
ORF Protein Sequence MFSTKALLLAGLISTALAGPWANICAGKSSNEIRTCDRHGCGQYSAQRSQRPHQGVDILCSAGSTVYAPFTGMIVGQEKPYQNKNAINNGVRISGRGFCVKMFYIKPIKYKGPIKKGEKLGTLLPLQKVYPGIQSHVHIENCDSSDPTAYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1066-Ab Anti-LECT2/ chm-II/ chm2 functional antibody
    Target Antigen GM-Tg-g-SE1066-Ag LECT2 protein
    ORF Viral Vector pGMLP001961 Human LECT2 Lentivirus plasmid
    ORF Viral Vector pGMAD001364 Human LECT2 Adenovirus plasmid
    ORF Viral Vector pGMAAV000594 Human LECT2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP001961 Human LECT2 Lentivirus particle
    ORF Viral Vector vGMAD001364 Human LECT2 Adenovirus particle
    ORF Viral Vector vGMAAV000594 Human LECT2 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1066
    Target Name LECT2
    Gene ID 3950, 16841, 712424, 361205, 101081021, 474687, 281899, 100629369
    Gene Symbol and Synonyms chm-II,chm2,LECT2
    Uniprot Accession O14960
    Uniprot Entry Name LECT2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000145826
    Target Classification Not Available

    This gene encodes a secreted, 16 kDa protein that acts as a chemotactic factor to neutrophils and stimulates the growth of chondrocytes and osteoblasts. This protein has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein. A polymorphism in this gene may be associated with rheumatoid arthritis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.