Human XCR1/CCXCR1/GPR5 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001024644.1)

Cat. No.: pGMAAV000894
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human XCR1/CCXCR1/GPR5 Adeno-associated virus expression plasmid (ITR-vector) for XCR1 AAV packaging, XCR1 AAV production.The purified Human XCR1/CCXCR1/GPR5 AAV particle serves as an invaluable asset for in-depth in vivo XCR1 studies, mechanism of action (MOA) research, and the evolution of XCR1-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to XCR1/CCXCR1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAAV000894
Gene Name XCR1
Accession Number NM_001024644.1
Gene ID 2829
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 1002 bp
Gene Alias CCXCR1,GPR5
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTCCTCAGGCAACCCAGAGAGCACCACCTTTTTTTACTATGACCTTCAGAGCCAGCCGTGTGAGAACCAGGCCTGGGTCTTTGCTACCCTCGCCACCACTGTCCTATACTGCCTGGTGTTTCTCCTCAGCCTAGTGGGCAACAGCCTGGTCCTGTGGGTCCTGGTGAAGTATGAGAGCCTGGAGTCCCTCACCAACATCTTCATCCTCAACCTGTGCCTCTCAGACCTGGTGTTCGCCTGCTTGTTGCCTGTGTGGATCTCCCCATACCACTGGGGCTGGGTGCTGGGAGACTTCCTCTGCAAACTCCTCAATATGATCTTCTCCATCAGCCTCTACAGCAGCATCTTCTTCCTGACCATCATGACCATCCACCGCTACCTGTCGGTAGTGAGCCCCCTCTCCACCCTGCGCGTCCCCACCCTCCGCTGCCGGGTGCTGGTGACCATGGCTGTGTGGGTAGCCAGCATCCTGTCCTCCATCCTCGACACCATCTTCCACAAGGTGCTTTCTTCGGGCTGTGATTATTCCGAACTCACGTGGTACCTCACCTCCGTCTACCAGCACAACCTCTTCTTCCTGCTGTCCCTGGGGATTATCCTGTTCTGCTACGTGGAGATCCTCAGGACCCTGTTCCGCTCACGCTCCAAGCGGCGCCACCGCACGGTCAAGCTCATCTTCGCCATCGTGGTGGCCTACTTCCTCAGCTGGGGTCCCTACAACTTCACCCTGTTTCTGCAGACGCTGTTTCGGACCCAGATCATCCGGAGCTGCGAGGCCAAACAGCAGCTAGAATACGCCCTGCTCATCTGCCGCAACCTCGCCTTCTCCCACTGCTGCTTTAACCCGGTGCTCTATGTCTTCGTGGGGGTCAAGTTCCGCACACACCTGAAACATGTTCTCCGGCAGTTCTGGTTCTGCCGGCTGCAGGCACCCAGCCCAGCCTCGATCCCCCACTCCCCTGGTGCCTTCGCCTATGAGGGCGCCTCCTTCTACTGA
ORF Protein Sequence MESSGNPESTTFFYYDLQSQPCENQAWVFATLATTVLYCLVFLLSLVGNSLVLWVLVKYESLESLTNIFILNLCLSDLVFACLLPVWISPYHWGWVLGDFLCKLLNMIFSISLYSSIFFLTIMTIHRYLSVVSPLSTLRVPTLRCRVLVTMAVWVASILSSILDTIFHKVLSSGCDYSELTWYLTSVYQHNLFFLLSLGIILFCYVEILRTLFRSRSKRRHRTVKLIFAIVVAYFLSWGPYNFTLFLQTLFRTQIIRSCEAKQQLEYALLICRNLAFSHCCFNPVLYVFVGVKFRTHLKHVLRQFWFCRLQAPSPASIPHSPGAFAYEGASFY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1940-Ab Anti-XCR1/ CCXCR1/ GPR5 monoclonal antibody
    Target Antigen GM-Tg-g-MP1940-Ag XCR1 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1940 X-C motif chemokine receptor 1 (XCR1) protein & antibody
    ORF Viral Vector pGMAAV000894 Human XCR1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001154 Human XCR1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMAAV000894 Human XCR1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001154 Human XCR1 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-MP1940
    Target Name XCR1
    Gene ID 2829, 23832, 713622, 301086, 111558429, 484792, 617880, 100065485
    Gene Symbol and Synonyms CCXCR1,GPR5,mXcr1,XCR1
    Uniprot Accession P46094
    Uniprot Entry Name XCR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000173578
    Target Classification GPCR

    The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Several alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.