Human FAM3A/2.19/DLD ORF/cDNA clone-Adenovirus plasmid (NM_021806.4)

Cat. No.: pGMAD000778
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FAM3A/2.19/DLD adenoviral expression plasmid for FAM3A adenovirus packaging, FAM3A adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FAM3A/2.19 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000778
Gene Name FAM3A
Accession Number NM_021806.4
Gene ID 60343
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 693 bp
Gene Alias 2.19,DLD,DXS560S,XAP-7
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGGTTGGCAGGCCCTCTCCGCATTGTGGTCCTAGTCGTCAGTGTGGGTGTCACATGGATCGTGGTCAGCATCCTCCTGGGTGGGCCTGGCAGTGGCTTTCCTCGCATCCAGCAACTCTTCACCAGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGGAAGTACAAGTGTGGCCTGCCCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCCGCCAACGTCATTGGGCCCAAGATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAACGTGGGCCGCGGGCTGAACATCGCCCTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCCCGGGCCTTTGACATGTGGGCCGGAGATGTCAACGACCTGTTGAAGTTTATTCGGCCACTGCACGAAGGCACCCTGGTGTTCGTGGCATCCTACGACGACCCAGCCACCAAGATGAATGAAGAGACCAGAAAGCTCTTCAGTGAGCTGGGCAGCAGGAACGCCAAGGAGCTGGCCTTCCGGGACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAACAAGAGCCCCTTTGAGCAGCACGTGAAGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCGCTGGAGATGGAAGGCTGTATCCCGCGGAGAAGCACGGCCAGCTAG
ORF Protein Sequence MRLAGPLRIVVLVVSVGVTWIVVSILLGGPGSGFPRIQQLFTSPESSVTAAPRARKYKCGLPQPCPEEHLAFRVVSGAANVIGPKICLEDKMLMSSVKDNVGRGLNIALVNGVSGELIEARAFDMWAGDVNDLLKFIRPLHEGTLVFVASYDDPATKMNEETRKLFSELGSRNAKELAFRDSWVFVGAKGVQNKSPFEQHVKNSKHSNKYEGWPEALEMEGCIPRRSTAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0203-Ab Anti-FAM3A/2.19/ DLD functional antibody
    Target Antigen GM-Tg-g-SE0203-Ag FAM3A protein
    ORF Viral Vector pGMLP004852 Human FAM3A Lentivirus plasmid
    ORF Viral Vector pGMAD000778 Human FAM3A Adenovirus plasmid
    ORF Viral Vector vGMLP004852 Human FAM3A Lentivirus particle
    ORF Viral Vector vGMAD000778 Human FAM3A Adenovirus particle


    Target information

    Target ID GM-SE0203
    Target Name FAM3A
    Gene ID 60343, 66294, 701159, 501664, 101085699, 119868558, 614075, 100059696
    Gene Symbol and Synonyms 1810037C20Rik,2.19,DLD,DXS560S,FAM3A,RGD1562076,XAP-7
    Uniprot Accession P98173
    Uniprot Entry Name FAM3A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000071889
    Target Classification Not Available

    This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.