Human FAM3A/2.19/DLD ORF/cDNA clone-Lentivirus plasmid (NM_021806)
Cat. No.: pGMLP004852
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human FAM3A/2.19/DLD Lentiviral expression plasmid for FAM3A lentivirus packaging, FAM3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
FAM3A/2.19 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004852 |
Gene Name | FAM3A |
Accession Number | NM_021806 |
Gene ID | 60343 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 693 bp |
Gene Alias | 2.19,DLD,DXS560S,XAP-7 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGGTTGGCAGGCCCTCTCCGCATTGTGGTCCTAGTCGTCAGTGTGGGTGTCACATGGATCGTGGTCAGCATCCTCCTGGGTGGGCCTGGCAGTGGCTTTCCTCGCATCCAGCAACTCTTCACCAGTCCAGAGAGCTCGGTGACTGCAGCGCCACGGGCCAGGAAGTACAAGTGTGGCCTGCCCCAGCCGTGTCCTGAGGAGCACCTGGCCTTCCGCGTGGTCAGCGGGGCCGCCAACGTCATTGGGCCCAAGATCTGCCTCGAGGACAAGATGCTGATGAGCAGCGTCAAGGACAACGTGGGCCGCGGGCTGAACATCGCCCTGGTGAACGGGGTCAGCGGCGAGCTCATCGAGGCCCGGGCCTTTGACATGTGGGCCGGAGATGTCAACGACCTGTTGAAGTTTATTCGGCCACTGCACGAAGGCACCCTGGTGTTCGTGGCATCCTACGACGACCCAGCCACCAAGATGAATGAAGAGACCAGAAAGCTCTTCAGTGAGCTGGGCAGCAGGAACGCCAAGGAGCTGGCCTTCCGGGACAGCTGGGTGTTTGTCGGGGCCAAGGGTGTGCAGAACAAGAGCCCCTTTGAGCAGCACGTGAAGAACAGTAAGCACAGCAACAAGTACGAAGGCTGGCCCGAGGCGCTGGAGATGGAAGGCTGTATCCCGCGGAGAAGCACGGCCAGCTAG |
ORF Protein Sequence | MRLAGPLRIVVLVVSVGVTWIVVSILLGGPGSGFPRIQQLFTSPESSVTAAPRARKYKCGLPQPCPEEHLAFRVVSGAANVIGPKICLEDKMLMSSVKDNVGRGLNIALVNGVSGELIEARAFDMWAGDVNDLLKFIRPLHEGTLVFVASYDDPATKMNEETRKLFSELGSRNAKELAFRDSWVFVGAKGVQNKSPFEQHVKNSKHSNKYEGWPEALEMEGCIPRRSTAS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0203-Ab | Anti-FAM3A/2.19/ DLD functional antibody |
Target Antigen | GM-Tg-g-SE0203-Ag | FAM3A protein |
ORF Viral Vector | pGMLP004852 | Human FAM3A Lentivirus plasmid |
ORF Viral Vector | pGMAD000778 | Human FAM3A Adenovirus plasmid |
ORF Viral Vector | vGMLP004852 | Human FAM3A Lentivirus particle |
ORF Viral Vector | vGMAD000778 | Human FAM3A Adenovirus particle |
Target information
Target ID | GM-SE0203 |
Target Name | FAM3A |
Gene ID | 60343, 66294, 701159, 501664, 101085699, 119868558, 614075, 100059696 |
Gene Symbol and Synonyms | 1810037C20Rik,2.19,DLD,DXS560S,FAM3A,RGD1562076,XAP-7 |
Uniprot Accession | P98173 |
Uniprot Entry Name | FAM3A_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000071889 |
Target Classification | Not Available |
This gene encodes a cytokine-like protein. The expression of this gene may be regulated by peroxisome proliferator-activated receptor gamma, and the encoded protein may be involved in the regulation of glucose and lipid metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.