Human TFAM/MTDPS15/ MTTF1 ORF/cDNA clone-Adenovirus plasmid (NM_003201)
Pre-made Human TFAM/MTDPS15/ MTTF1 adenoviral expression plasmid for TFAM adenovirus packaging, TFAM adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to TFAM/MTDPS15 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAD000841 | Human TFAM Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAD000841 |
Gene Name | TFAM |
Accession Number | NM_003201 |
Gene ID | 7019 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 741 bp |
Gene Alias | MTDPS15, MTTF1, MTTFA, TCF6, TCF6L1, TCF6L2, TCF6L3 |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAGCTGTGCACCGGCTGTGGAAGTCGACTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGGTGGTTTTCATCTGTCTTGGCAAGTTGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTTTCTAAAGAACAACTACCCATATTTAAAGCTCAGAACCCAGATGCAAAAACTACAGAACTAATTAGAAGAATTGCCCAGCGTTGGAGGGAACTTCCTGATTCAAAGAAAAAAATATATCAAGATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAATAAAGAAACAACGAAAATATGGTGCTGAGGAGTGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1454-Ab | Anti-TFAM/ MTDPS15/ MTTF1 functional antibody |
Target Antigen | GM-Tg-g-SE1454-Ag | TFAM protein |
ORF Viral Vector | pGMAD000692 | Human TFAM Adenovirus plasmid |
ORF Viral Vector | pGMAD000841 | Human TFAM Adenovirus plasmid |
ORF Viral Vector | pGMAAV000028 | Human TFAM Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMAD000692 | Human TFAM Adenovirus particle |
ORF Viral Vector | vGMAD000841 | Human TFAM Adenovirus particle |
ORF Viral Vector | vGMAAV000028 | Human TFAM Adeno-associate virus(AAV) particle |
ORF Viral Vector | pGMLV002343 | Human TFAM Lentivirus plasmid |
Target information
Target ID | GM-SE1454 |
Target Name | TFAM |
Gene ID | 7019, 21780, 701368, 83474, 101096672, 488989, 510059, 100062631 |
Gene Symbol and Synonyms | Hmgts,MTDPS15,MTTF1,MTTFA,TCF6,TCF6L1,TCF6L2,TCF6L3,TFAM,tsHMG |
Uniprot Accession | Q00059 |
Uniprot Entry Name | TFAM_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000108064 |
Target Classification | Not Available |
This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.