Human TFAM/MTDPS15/ MTTF1 ORF/cDNA clone-Adenovirus particle (NM_003201)

Pre-made Human TFAM/MTDPS15/ MTTF1 Adenovirus for TFAM overexpression in-vitro and in-vivo. The TFAM adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TFAM-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TFAM/MTDPS15 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000692 Human TFAM Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000692
Gene Name TFAM
Accession Number NM_003201
Gene ID 7019
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 741 bp
Gene Alias MTDPS15, MTTF1, MTTFA, TCF6, TCF6L1, TCF6L2, TCF6L3
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAGCTGTGCACCGGCTGTGGAAGTCGACTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGGTGGTTTTCATCTGTCTTGGCAAGTTGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTTTCTAAAGAACAACTACCCATATTTAAAGCTCAGAACCCAGATGCAAAAACTACAGAACTAATTAGAAGAATTGCCCAGCGTTGGAGGGAACTTCCTGATTCAAAGAAAAAAATATATCAAGATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAAAAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATATATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAACAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAATAAAGAAACAACGAAAATATGGTGCTGAGGAGTGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1454-Ab Anti-TFAM/ MTDPS15/ MTTF1 functional antibody
    Target Antigen GM-Tg-g-SE1454-Ag TFAM protein
    ORF Viral Vector pGMAD000692 Human TFAM Adenovirus plasmid
    ORF Viral Vector pGMAD000841 Human TFAM Adenovirus plasmid
    ORF Viral Vector pGMAAV000028 Human TFAM Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMAD000692 Human TFAM Adenovirus particle
    ORF Viral Vector vGMAD000841 Human TFAM Adenovirus particle
    ORF Viral Vector vGMAAV000028 Human TFAM Adeno-associate virus(AAV) particle
    ORF Viral Vector pGMLV002343 Human TFAM Lentivirus plasmid


    Target information

    Target ID GM-SE1454
    Target Name TFAM
    Gene ID 7019, 21780, 701368, 83474, 101096672, 488989, 510059, 100062631
    Gene Symbol and Synonyms Hmgts,MTDPS15,MTTF1,MTTFA,TCF6,TCF6L1,TCF6L2,TCF6L3,TFAM,tsHMG
    Uniprot Accession Q00059
    Uniprot Entry Name TFAM_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000108064
    Target Classification Not Available

    This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.