Human IL37/FIL1/ FIL1(ZETA) ORF/cDNA clone-Lentivirus plasmid (NM_014439)
Pre-made Human IL37/FIL1/ FIL1(ZETA) Lentiviral expression plasmid for IL37 lentivirus packaging, IL37 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL37/FIL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP-IL-043 | Human IL37 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP-IL-043 |
Gene Name | IL37 |
Accession Number | NM_014439 |
Gene ID | 27178 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 657 bp |
Gene Alias | FIL1, FIL1(ZETA), FIL1Z, IL-1F7, IL-1H, IL-1H4, IL-1RP1, IL-37, IL1F7, IL1H4, IL1RP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGATGAACCCCAGTGCTGCTTAGAAGACCCGGCTGGAAGCCCCCTGGAACCAGGCCCAAGCCTCCCCACCATGAATTTTGTTCACACAAGTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGCATTCATGACCAGGATCACAAAGTACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCAGATAAAAACTACATACGCCCAGAGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCCGATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAAGTCATCCATCCCTTCAGCTGAAGAAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTTTATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTCATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGGAAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTCAGCGATTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T96845-Ab | Anti-IL37/ FIL1/ FIL1(ZETA) functional antibody |
Target Antigen | GM-Tg-g-T96845-Ag | IL37 protein |
Cytokine | cks-Tg-g-GM-T96845 | interleukin 37 (IL37) protein & antibody |
ORF Viral Vector | pGMLV000120 | Human IL37 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000475 | Human IL37 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000269 | Human IL37 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-043 | Human IL37 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-126 | Human IL37 Adenovirus plasmid |
ORF Viral Vector | vGMLV000120 | Human IL37 Lentivirus particle |
ORF Viral Vector | vGMAAV000475 | Human IL37 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000269 | Human IL37 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-043 | Human IL37 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-126 | Human IL37 Adenovirus particle |
Target information
Target ID | GM-T96845 |
Target Name | IL37 |
Gene ID | 27178, 700579, 100686057, 786493, 100052470 |
Gene Symbol and Synonyms | FIL1,FIL1(ZETA),FIL1Z,IL-1F7,IL-1H,IL-1H4,IL-1RP1,IL-23,IL-37,IL1F7,IL1H4,IL1RP1,IL37 |
Uniprot Accession | Q9NZH6 |
Uniprot Entry Name | IL37_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000125571 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.