Human IL37/FIL1/ FIL1(ZETA) ORF/cDNA clone-Adenovirus plasmid (NM_014439)

Pre-made Human IL37/FIL1/ FIL1(ZETA) adenoviral expression plasmid for IL37 adenovirus packaging, IL37 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to IL37/FIL1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP-IL-126 Human IL37 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP-IL-126
Gene Name IL37
Accession Number NM_014439
Gene ID 27178
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 657 bp
Gene Alias FIL1, FIL1(ZETA), FIL1Z, IL-1F7, IL-1H, IL-1H4, IL-1RP1, IL-37, IL1F7, IL1H4, IL1RP1
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCTTTGTGGGGGAGAACTCAGGAGTGAAAATGGGCTCTGAGGACTGGGAAAAAGATGAACCCCAGTGCTGCTTAGAAGACCCGGCTGGAAGCCCCCTGGAACCAGGCCCAAGCCTCCCCACCATGAATTTTGTTCACACAAGTCCAAAGGTGAAGAACTTAAACCCGAAGAAATTCAGCATTCATGACCAGGATCACAAAGTACTGGTCCTGGACTCTGGGAATCTCATAGCAGTTCCAGATAAAAACTACATACGCCCAGAGATCTTCTTTGCATTAGCCTCATCCTTGAGCTCAGCCTCTGCGGAGAAAGGAAGTCCGATTCTCCTGGGGGTCTCTAAAGGGGAGTTTTGTCTCTACTGTGACAAGGATAAAGGACAAAGTCATCCATCCCTTCAGCTGAAGAAGGAGAAACTGATGAAGCTGGCTGCCCAAAAGGAATCAGCACGCCGGCCCTTCATCTTTTATAGGGCTCAGGTGGGCTCCTGGAACATGCTGGAGTCGGCGGCTCACCCCGGATGGTTCATCTGCACCTCCTGCAATTGTAATGAGCCTGTTGGGGTGACAGATAAATTTGAGAACAGGAAACACATTGAATTTTCATTTCAACCAGTTTGCAAAGCTGAAATGAGCCCCAGTGAGGTCAGCGATTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T96845-Ab Anti-IL37/ FIL1/ FIL1(ZETA) functional antibody
    Target Antigen GM-Tg-g-T96845-Ag IL37 protein
    Cytokine cks-Tg-g-GM-T96845 interleukin 37 (IL37) protein & antibody
    ORF Viral Vector pGMLV000120 Human IL37 Lentivirus plasmid
    ORF Viral Vector pGMAAV000475 Human IL37 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000269 Human IL37 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-043 Human IL37 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-126 Human IL37 Adenovirus plasmid
    ORF Viral Vector vGMLV000120 Human IL37 Lentivirus particle
    ORF Viral Vector vGMAAV000475 Human IL37 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000269 Human IL37 Adenovirus particle
    ORF Viral Vector vGMLP-IL-043 Human IL37 Lentivirus particle
    ORF Viral Vector vGMAP-IL-126 Human IL37 Adenovirus particle


    Target information

    Target ID GM-T96845
    Target Name IL37
    Gene ID 27178, 700579, 100686057, 786493, 100052470
    Gene Symbol and Synonyms FIL1,FIL1(ZETA),FIL1Z,IL-1F7,IL-1H,IL-1H4,IL-1RP1,IL-23,IL-37,IL1F7,IL1H4,IL1RP1,IL37
    Uniprot Accession Q9NZH6
    Uniprot Entry Name IL37_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000125571
    Target Classification Not Available

    The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.