Human GSK3B ORF/cDNA clone-Lentivirus plasmid (NM_001146156.1)

Pre-made Human GSK3B/ Lentiviral expression plasmid for GSK3B lentivirus packaging, GSK3B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GSK-3B/GSK3B/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP-SPh-134 Human GSK3B Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP-SPh-134
Gene Name GSK3B
Accession Number NM_001146156.1
Gene ID 2932
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1263 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCTTCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTGGTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAACTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATCATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGTGAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATACAGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTGTATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGGGATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGACTTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGGTACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTATGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGATAGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAAATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCTTGGACTAAGGTCTTCCGACCCCGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCCCGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAATGTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTGTCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCTGCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAGACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T70977-Ab Anti-GSK-3B monoclonal antibody
    Target Antigen GM-Tg-g-T70977-Ag GSK-3B/GSK3B protein
    ORF Viral Vector pGMAD001170 Human GSK3B Adenovirus plasmid
    ORF Viral Vector pGMAAV000150 Human GSK3B Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000126 Human GSK3B Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000726 Human GSK3B Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000853 Human A2M Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000889 Rat Gsk3b Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP-SPh-089 Human GSK3B Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-134 Human GSK3B Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-229 Human GSK3B Adenovirus plasmid
    ORF Viral Vector pGMAP-SPh-274 Human GSK3B Adenovirus plasmid
    ORF Viral Vector vGMAD001170 Human GSK3B Adenovirus particle
    ORF Viral Vector vGMAAV000150 Human GSK3B Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP-SPh-089 Human GSK3B Lentivirus particle
    ORF Viral Vector vGMLP-SPh-134 Human GSK3B Lentivirus particle
    ORF Viral Vector vGMAP-SPh-229 Human GSK3B Adenovirus particle
    ORF Viral Vector vGMAP-SPh-274 Human GSK3B Adenovirus particle


    Target information

    Target ID GM-T70977
    Target Name GSK-3B
    Gene ID 2932, 56637, 713114, 84027, 101081660, 478575, 790875, 100061033
    Gene Symbol and Synonyms 7330414F15Rik,8430431H08Rik,GSK-3,GSK-3beta,GSK3,GSK3B,GSK3beta
    Uniprot Accession P49841
    Uniprot Entry Name GSK3B_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000082701
    Target Classification Kinase

    The protein encoded by this gene is a serine-threonine kinase belonging to the glycogen synthase kinase subfamily. It is a negative regulator of glucose homeostasis and is involved in energy metabolism, inflammation, ER-stress, mitochondrial dysfunction, and apoptotic pathways. Defects in this gene have been associated with Parkinson disease and Alzheimer disease. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.