Human p38/p38/PDIP38 ORF/cDNA clone-Lentivirus plasmid (NM_015584)

Cat. No.: pGMLP-SPh-151
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human p38/p38/PDIP38 Lentiviral expression plasmid for p38 lentivirus packaging, p38 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to POLDIP2/p38 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $609.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP-SPh-151
Gene Name p38
Accession Number NM_015584
Gene ID 26073
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1107 bp
Gene Alias p38,PDIP38,POLD4
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGCCTGTACAGCCCGGCGGGCCCTGGCCGTGGGCAGCCGCTGGTGGTCCCGGTCGCTGACTGGGGCCCGGTGGCCAAGGCCGCTCTGTGCGGCGGCCGGAGCTGGAGCCTTCTCGCCAGCGTCGACCACGACGACGCGGAGGCACCTCTCGTCCCGAAACCGACCAGAGGGCAAAGTGTTGGAGACAGTTGGTGTGTTTGAGGTGCCAAAACAGAATGGAAAATATGAGACCGGGCAGCTTTTCCTTCATAGCATTTTTGGCTACCGAGGTGTCGTCCTGTTTCCCTGGCAGGCCAGACTGTATGACCGGGATGTGGCTTCTGCAGCTCCAGAAAAAGCAGAGAACCCTGCTGGCCATGGCTCCAAGGAGGTGAAAGGCAAAACTCACACTTACTATCAGGTGCTGATTGATGCTCGTGACTGCCCACATATATCTCAGAGATCTCAGACAGAAGCTGTGACCTTCTTGGCTAACCATGATGACAGTCGGGCCCTCTATGCCATCCCAGGCTTGGACTATGTCAGCCATGAAGACATCCTCCCCTACACCTCCACTGATCAGGTTCCCATCCAACATGAACTCTTTGAAAGATTTCTTCTGTATGACCAGACAAAAGCACCTCCTTTTGTGGCTCGGGAGACGCTAAGGGCCTGGCAAGAGAAGAATCACCCCTGGCTGGAGCTCTCCGATGTTCATCGGGAAACAACTGAGAACATACGTGTCACTGTCATCCCCTTCTACATGGGCATGAGGGAAGCCCAGAATTCCCACGTGTACTGGTGGCGCTACTGTATCCGTTTGGAGAACCTTGACAGTGATGTGGTACAGCTCCGGGAGCGGCACTGGAGGATATTCAGTCTCTCTGGCACCTTGGAGACAGTGCGAGGCCGAGGGGTAGTGGGCAGGGAACCAGTGTTATCCAAGGAGCAGCCTGCGTTCCAGTATAGCAGCCACGTCTCGCTGCAGGCTTCCAGTGGGCACATGTGGGGCACGTTCCGCTTTGAAAGACCTGATGGCTCCCACTTTGATGTTCGGATTCCTCCCTTCTCCCTGGAAAGCAATAAAGATGAGAAGACACCACCCTCAGGCCTTCACTGGTAG
ORF Protein Sequence MAACTARRALAVGSRWWSRSLTGARWPRPLCAAAGAGAFSPASTTTTRRHLSSRNRPEGKVLETVGVFEVPKQNGKYETGQLFLHSIFGYRGVVLFPWQARLYDRDVASAAPEKAENPAGHGSKEVKGKTHTYYQVLIDARDCPHISQRSQTEAVTFLANHDDSRALYAIPGLDYVSHEDILPYTSTDQVPIQHELFERFLLYDQTKAPPFVARETLRAWQEKNHPWLELSDVHRETTENIRVTVIPFYMGMREAQNSHVYWWRYCIRLENLDSDVVQLRERHWRIFSLSGTLETVRGRGVVGREPVLSKEQPAFQYSSHVSLQASSGHMWGTFRFERPDGSHFDVRIPPFSLESNKDEKTPPSGLHW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMLV000917 Human POLDIP2 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-151 Human p38 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-302 Human p38 Adenovirus plasmid
    ORF Viral Vector pGMPC000644 Human POLDIP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000917 Human POLDIP2 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-151 Human p38 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-302 Human p38 Adenovirus particle


    Target information

    Target ID GM-IP4021
    Target Name POLDIP2
    Gene ID 26073, 67811, 707994, 287544, 101086355, 491162, 539673, 100072037
    Gene Symbol and Synonyms 1300003F06Rik,p38,PDIP38,POLD4,POLDIP2
    Uniprot Accession Q9Y2S7
    Uniprot Entry Name PDIP2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000004142
    Target Classification Not Available

    This gene encodes a protein that interacts with the DNA polymerase delta p50 subunit, as well as with proliferating cell nuclear antigen. The encoded protein maybe play a role in the ability of the replication fork to bypass DNA lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.