Human p38/p38/PDIP38 ORF/cDNA clone-Adenovirus particle (NM_015584)
Cat. No.: vGMAP-SPh-302
Pre-made Human p38/p38/PDIP38 Adenovirus for p38 overexpression in-vitro and in-vivo. The p38 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified p38-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
POLDIP2/p38 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-302 | Human p38 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-302 |
| Gene Name | p38 |
| Accession Number | NM_015584 |
| Gene ID | 26073 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1107 bp |
| Gene Alias | p38,PDIP38,POLD4 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCAGCCTGTACAGCCCGGCGGGCCCTGGCCGTGGGCAGCCGCTGGTGGTCCCGGTCGCTGACTGGGGCCCGGTGGCCAAGGCCGCTCTGTGCGGCGGCCGGAGCTGGAGCCTTCTCGCCAGCGTCGACCACGACGACGCGGAGGCACCTCTCGTCCCGAAACCGACCAGAGGGCAAAGTGTTGGAGACAGTTGGTGTGTTTGAGGTGCCAAAACAGAATGGAAAATATGAGACCGGGCAGCTTTTCCTTCATAGCATTTTTGGCTACCGAGGTGTCGTCCTGTTTCCCTGGCAGGCCAGACTGTATGACCGGGATGTGGCTTCTGCAGCTCCAGAAAAAGCAGAGAACCCTGCTGGCCATGGCTCCAAGGAGGTGAAAGGCAAAACTCACACTTACTATCAGGTGCTGATTGATGCTCGTGACTGCCCACATATATCTCAGAGATCTCAGACAGAAGCTGTGACCTTCTTGGCTAACCATGATGACAGTCGGGCCCTCTATGCCATCCCAGGCTTGGACTATGTCAGCCATGAAGACATCCTCCCCTACACCTCCACTGATCAGGTTCCCATCCAACATGAACTCTTTGAAAGATTTCTTCTGTATGACCAGACAAAAGCACCTCCTTTTGTGGCTCGGGAGACGCTAAGGGCCTGGCAAGAGAAGAATCACCCCTGGCTGGAGCTCTCCGATGTTCATCGGGAAACAACTGAGAACATACGTGTCACTGTCATCCCCTTCTACATGGGCATGAGGGAAGCCCAGAATTCCCACGTGTACTGGTGGCGCTACTGTATCCGTTTGGAGAACCTTGACAGTGATGTGGTACAGCTCCGGGAGCGGCACTGGAGGATATTCAGTCTCTCTGGCACCTTGGAGACAGTGCGAGGCCGAGGGGTAGTGGGCAGGGAACCAGTGTTATCCAAGGAGCAGCCTGCGTTCCAGTATAGCAGCCACGTCTCGCTGCAGGCTTCCAGTGGGCACATGTGGGGCACGTTCCGCTTTGAAAGACCTGATGGCTCCCACTTTGATGTTCGGATTCCTCCCTTCTCCCTGGAAAGCAATAAAGATGAGAAGACACCACCCTCAGGCCTTCACTGGTAG |
| ORF Protein Sequence | MAACTARRALAVGSRWWSRSLTGARWPRPLCAAAGAGAFSPASTTTTRRHLSSRNRPEGKVLETVGVFEVPKQNGKYETGQLFLHSIFGYRGVVLFPWQARLYDRDVASAAPEKAENPAGHGSKEVKGKTHTYYQVLIDARDCPHISQRSQTEAVTFLANHDDSRALYAIPGLDYVSHEDILPYTSTDQVPIQHELFERFLLYDQTKAPPFVARETLRAWQEKNHPWLELSDVHRETTENIRVTVIPFYMGMREAQNSHVYWWRYCIRLENLDSDVVQLRERHWRIFSLSGTLETVRGRGVVGREPVLSKEQPAFQYSSHVSLQASSGHMWGTFRFERPDGSHFDVRIPPFSLESNKDEKTPPSGLHW |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| ORF Viral Vector | pGMLV000917 | Human POLDIP2 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-151 | Human p38 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-302 | Human p38 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000644 | Human POLDIP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000917 | Human POLDIP2 Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-151 | Human p38 Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-302 | Human p38 Adenovirus particle |
Target information
| Target ID | GM-IP4021 |
| Target Name | POLDIP2 |
| Gene ID | 26073, 67811, 707994, 287544, 101086355, 491162, 539673, 100072037 |
| Gene Symbol and Synonyms | 1300003F06Rik,p38,PDIP38,POLD4,POLDIP2 |
| Uniprot Accession | Q9Y2S7 |
| Uniprot Entry Name | PDIP2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000004142 |
| Target Classification | Not Available |
This gene encodes a protein that interacts with the DNA polymerase delta p50 subunit, as well as with proliferating cell nuclear antigen. The encoded protein maybe play a role in the ability of the replication fork to bypass DNA lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


