Human SELENOM/SELM/ SEPM ORF/cDNA clone-Lentivirus plasmid (NM_080430)

Pre-made Human SELENOM/SELM/ SEPM Lentiviral expression plasmid for SELENOM lentivirus packaging, SELENOM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SELENOM/SELM products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000002 Human SELENOM Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000002
Gene Name SELENOM
Accession Number NM_080430
Gene ID 140606
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 438 bp
Gene Alias SELM, SEPM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCTCCTGTTGCCTCCGCTGGCGCTGCTGCTGCTTCTCGCGGCGCTTGTGGCCCCAGCCACAGCCGCCACTGCCTACCGGCCGGACTGGAACCGTCTGAGCGGCCTAACCCGCGCCCGGGTAGAGACCTGCGGGGGATGACAGCTGAACCGCCTAAAGGAGGTGAAGGCTTTCGTCACGCAGGACATTCCATTCTATCACAACCTGGTGATGAAACACCTCCCTGGGGCCGACCCTGAGCTCGTGCTGCTGGGCCGCCGCTACGAGGAACTAGAGCGCATCCCACTCAGTGAAATGACCCGCGAAGAGATCAATGCGCTAGTGCAGGAGCTCGGCTTCTACCGCAAGGCGGCGCCCGACGCGCAGGTGCCCCCCGAGTACGTGTGGGCGCCCGCGAAGCCCCCAGAGGAAACTTCGGACCACGCTGACCTGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1651-Ab Anti-SELM/ SELENOM/ SEPM functional antibody
    Target Antigen GM-Tg-g-SE1651-Ag SELENOM protein
    ORF Viral Vector pGMAD000365 Human SELENOM Adenovirus plasmid
    ORF Viral Vector pGMLP000002 Human SELENOM Lentivirus plasmid
    ORF Viral Vector pGMLP002806 Human SELENOM Lentivirus plasmid
    ORF Viral Vector vGMAD000365 Human SELENOM Adenovirus particle
    ORF Viral Vector vGMLP000002 Human SELENOM Lentivirus particle
    ORF Viral Vector vGMLP002806 Human SELENOM Lentivirus particle


    Target information

    Target ID GM-SE1651
    Target Name SELENOM
    Gene ID 140606, 114679, 718290, 498398, 101095443, 611981, 787736, 100063305
    Gene Symbol and Synonyms 1500040L08Rik,A230103K18,RGD1565037,SELENOM,SELM,SEPM
    Uniprot Accession Q8WWX9
    Uniprot Entry Name SELM_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000198832
    Target Classification Not Available

    The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.