Human SELENOM/SELM/ SEPM ORF/cDNA clone-Lentivirus plasmid (NM_080430)
Pre-made Human SELENOM/SELM/ SEPM Lentiviral expression plasmid for SELENOM lentivirus packaging, SELENOM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SELENOM/SELM products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000002 | Human SELENOM Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000002 |
Gene Name | SELENOM |
Accession Number | NM_080430 |
Gene ID | 140606 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 438 bp |
Gene Alias | SELM, SEPM |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCTCCTGTTGCCTCCGCTGGCGCTGCTGCTGCTTCTCGCGGCGCTTGTGGCCCCAGCCACAGCCGCCACTGCCTACCGGCCGGACTGGAACCGTCTGAGCGGCCTAACCCGCGCCCGGGTAGAGACCTGCGGGGGATGACAGCTGAACCGCCTAAAGGAGGTGAAGGCTTTCGTCACGCAGGACATTCCATTCTATCACAACCTGGTGATGAAACACCTCCCTGGGGCCGACCCTGAGCTCGTGCTGCTGGGCCGCCGCTACGAGGAACTAGAGCGCATCCCACTCAGTGAAATGACCCGCGAAGAGATCAATGCGCTAGTGCAGGAGCTCGGCTTCTACCGCAAGGCGGCGCCCGACGCGCAGGTGCCCCCCGAGTACGTGTGGGCGCCCGCGAAGCCCCCAGAGGAAACTTCGGACCACGCTGACCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1651-Ab | Anti-SELM/ SELENOM/ SEPM functional antibody |
Target Antigen | GM-Tg-g-SE1651-Ag | SELENOM protein |
ORF Viral Vector | pGMAD000365 | Human SELENOM Adenovirus plasmid |
ORF Viral Vector | pGMLP000002 | Human SELENOM Lentivirus plasmid |
ORF Viral Vector | pGMLP002806 | Human SELENOM Lentivirus plasmid |
ORF Viral Vector | vGMAD000365 | Human SELENOM Adenovirus particle |
ORF Viral Vector | vGMLP000002 | Human SELENOM Lentivirus particle |
ORF Viral Vector | vGMLP002806 | Human SELENOM Lentivirus particle |
Target information
Target ID | GM-SE1651 |
Target Name | SELENOM |
Gene ID | 140606, 114679, 718290, 498398, 101095443, 611981, 787736, 100063305 |
Gene Symbol and Synonyms | 1500040L08Rik,A230103K18,RGD1565037,SELENOM,SELM,SEPM |
Uniprot Accession | Q8WWX9 |
Uniprot Entry Name | SELM_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000198832 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.