Human LSMD1/MGC14151/PFAAP2 ORF/cDNA clone-Lentivirus plasmid (BC059944)

Cat. No.: pGMLP000024
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LSMD1/MGC14151/PFAAP2 Lentiviral expression plasmid for LSMD1 lentivirus packaging, LSMD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NAA38/LSMD1/MGC14151 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000024
Gene Name LSMD1
Accession Number BC059944
Gene ID 84316
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 378 bp
Gene Alias MGC14151,PFAAP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGGAGCTGGACCGACCATGCTGCTACGAGAAGAGAATGGCTGTTGCAGTCGGCGTCAGAGCAGCTCCAGTGCCGGGGATTCGGACGGAGAGCGCGAGGACTCGGCGGCTGAGCGCGCCCGACAGCAGCTAGAGGCGCTGCTCAACAAGACTATGCGCATTCGCATGACAGATGGACGGACACTGGTCGGCTGCTTTCTCTGCACTGACCGTGACTGCAATGTCATCCTGGGCTCGGCGCAGGAGTTCCTCAAGCCGTCGGATTCCTTCTCTGCCGGGGAGCCCCGTGTGCTGGGCCTGGCCATGGTACCCGGACACCACATCGTTTCCATTGAGGTGCAGAGGGAGAGTCTGACCGGGCCTCCGTATCTCTGA
ORF Protein Sequence MAGAGPTMLLREENGCCSRRQSSSSAGDSDGEREDSAAERARQQLEALLNKTMRIRMTDGRTLVGCFLCTDRDCNVILGSAQEFLKPSDSFSAGEPRVLGLAMVPGHHIVSIEVQRESLTGPPYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1630-Ab Anti-LSMD1/ NAA38/ MAK31 functional antibody
    Target Antigen GM-Tg-g-SE1630-Ag NAA38 protein
    ORF Viral Vector pGMLP000024 Human LSMD1 Lentivirus plasmid
    ORF Viral Vector vGMLP000024 Human LSMD1 Lentivirus particle


    Target information

    Target ID GM-SE1630
    Target Name NAA38
    Gene ID 84316, 78304, 716462, 287429, 101100516, 479488, 538931, 100062142
    Gene Symbol and Synonyms 1500034E06Rik,LSMD1,MAK31,NAA38,PFAAP2,RGD1559617
    Uniprot Accession Q9BRA0
    Uniprot Entry Name LSMD1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183011
    Target Classification Not Available

    Involved in negative regulation of apoptotic process. Located in cytoplasm and nucleoplasm. Part of NatC complex. Colocalizes with polysome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.