Human NAA38/MGC14151/ PFAAP2 ORF/cDNA clone-Lentivirus particle (BC059944)

Pre-made Human NAA38/MGC14151/ PFAAP2 Lentiviral expression plasmid for NAA38 lentivirus packaging, NAA38 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to NAA38/MGC14151 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000024 Human NAA38 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000024
Gene Name NAA38
Accession Number BC059944
Gene ID 84316
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 378 bp
Gene Alias MGC14151, PFAAP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGGAGCTGGACCGACCATGCTGCTACGAGAAGAGAATGGCTGTTGCAGTCGGCGTCAGAGCAGCTCCAGTGCCGGGGATTCGGACGGAGAGCGCGAGGACTCGGCGGCTGAGCGCGCCCGACAGCAGCTAGAGGCGCTGCTCAACAAGACTATGCGCATTCGCATGACAGATGGACGGACACTGGTCGGCTGCTTTCTCTGCACTGACCGTGACTGCAATGTCATCCTGGGCTCGGCGCAGGAGTTCCTCAAGCCGTCGGATTCCTTCTCTGCCGGGGAGCCCCGTGTGCTGGGCCTGGCCATGGTACCCGGACACCACATCGTTTCCATTGAGGTGCAGAGGGAGAGTCTGACCGGGCCTCCGTATCTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1630-Ab Anti-LSMD1/ NAA38/ MAK31 functional antibody
    Target Antigen GM-Tg-g-SE1630-Ag NAA38 protein
    ORF Viral Vector pGMLP000024 Human NAA38 Lentivirus plasmid
    ORF Viral Vector vGMLP000024 Human NAA38 Lentivirus particle


    Target information

    Target ID GM-SE1630
    Target Name NAA38
    Gene ID 84316, 78304, 716462, 287429, 101100516, 479488, 538931, 100062142
    Gene Symbol and Synonyms 1500034E06Rik,LSMD1,MAK31,NAA38,PFAAP2,RGD1559617
    Uniprot Accession Q9BRA0
    Uniprot Entry Name LSMD1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000183011
    Target Classification Not Available

    Involved in negative regulation of apoptotic process. Located in cytoplasm and nucleoplasm. Part of NatC complex. Colocalizes with polysome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.