Human TUBB2A/CDCBM5/ TUBB ORF/cDNA clone-Lentivirus plasmid (NM_001069)

Pre-made Human TUBB2A/CDCBM5/ TUBB Lentiviral expression plasmid for TUBB2A lentivirus packaging, TUBB2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TUBB2/TUBB2A/CDCBM5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000050 Human TUBB2A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000050
Gene Name TUBB2A
Accession Number NM_001069
Gene ID 7280
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1338 bp
Gene Alias CDCBM5, TUBB, TUBB2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGCGAGATCGTGCACATCCAGGCGGGCCAGTGCGGCAACCAGATCGGCGCCAAGTTTTGGGAGGTCATCAGCGATGAGCATGGGATCGACCCCACAGGCAGTTACCATGGAGACAGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAATGAGGCTGCTGGTAACAAATATGTACCTCGGGCCATCCTGGTGGATCTGGAGCCTGGCACCATGGACTCTGTCAGGTCTGGACCCTTCGGCCAGATCTTCAGACCAGACAACTTCGTGTTCGGCCAGAGTGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTCGGTCCTGGATGTGGTGAGGAAGGAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCTCTGGGGGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGGAAAACACAGATGAAACCTACTCCATTGATAACGAGGCCCTGTATGACATCTGCTTCCGCACCCTGAAGCTGACCACCCCCACCTACGGGGACCTCAACCACCTGGTGTCGGCCACCATGAGCGGGGTCACCACCTGCCTGCGCTTCCCGGGCCAGCTGAACGCAGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCTCGCCTGCACTTCTTCATGCCCGGCTTCGCGCCCCTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTCACGGTGCCCGAGCTCACCCAGCAGATGTTCGACTCCAAGAACATGATGGCCGCCTGCGACCCGCGCCACGGCCGCTACCTGACGGTGGCTGCCATCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTCAACGTGCAGAACAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTGAAGACGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGTCGGCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGACGCCACGGCCGACGAACAAGGGGAGTTCGAGGAGGAGGAGGGCGAGGACGAGGCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28661-Ab Anti-TUBB2 monoclonal antibody
    Target Antigen GM-Tg-g-T28661-Ag TUBB2/TUBB2A protein
    ORF Viral Vector pGMLP000050 Human TUBB2A Lentivirus plasmid
    ORF Viral Vector vGMLP000050 Human TUBB2A Lentivirus particle


    Target information

    Target ID GM-T28661
    Target Name TUBB2
    Gene ID 7280, 22151, 109499596, 478701, 100295973, 100629875
    Gene Symbol and Synonyms CDCBM5,M(beta)2,TUBB,TUBB2,TUBB2A
    Uniprot Accession Q13885
    Uniprot Entry Name TBB2A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000137267
    Target Classification Not Available

    Microtubules, key participants in processes such as mitosis and intracellular transport, are composed of heterodimers of alpha- and beta-tubulins. The protein encoded by this gene is a beta-tubulin. Defects in this gene are associated with complex cortical dysplasia with other brain malformations-5. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.