Human TUBB2A/CDCBM5/ TUBB ORF/cDNA clone-Lentivirus plasmid (NM_001069)
Pre-made Human TUBB2A/CDCBM5/ TUBB Lentiviral expression plasmid for TUBB2A lentivirus packaging, TUBB2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TUBB2/TUBB2A/CDCBM5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000050 | Human TUBB2A Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000050 |
Gene Name | TUBB2A |
Accession Number | NM_001069 |
Gene ID | 7280 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1338 bp |
Gene Alias | CDCBM5, TUBB, TUBB2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGCGAGATCGTGCACATCCAGGCGGGCCAGTGCGGCAACCAGATCGGCGCCAAGTTTTGGGAGGTCATCAGCGATGAGCATGGGATCGACCCCACAGGCAGTTACCATGGAGACAGTGACTTGCAGCTGGAGAGAATCAACGTGTACTACAATGAGGCTGCTGGTAACAAATATGTACCTCGGGCCATCCTGGTGGATCTGGAGCCTGGCACCATGGACTCTGTCAGGTCTGGACCCTTCGGCCAGATCTTCAGACCAGACAACTTCGTGTTCGGCCAGAGTGGAGCCGGGAATAACTGGGCCAAGGGCCACTACACAGAGGGAGCCGAGCTGGTCGACTCGGTCCTGGATGTGGTGAGGAAGGAGTCAGAGAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACCCACTCTCTGGGGGGCGGCACGGGGTCCGGGATGGGCACCCTGCTCATCAGCAAGATCCGGGAAGAGTACCCAGACCGCATCATGAACACCTTCAGCGTCATGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACCCTCTCTGTCCACCAGCTGGTGGAAAACACAGATGAAACCTACTCCATTGATAACGAGGCCCTGTATGACATCTGCTTCCGCACCCTGAAGCTGACCACCCCCACCTACGGGGACCTCAACCACCTGGTGTCGGCCACCATGAGCGGGGTCACCACCTGCCTGCGCTTCCCGGGCCAGCTGAACGCAGACCTGCGCAAGCTGGCGGTGAACATGGTGCCCTTCCCTCGCCTGCACTTCTTCATGCCCGGCTTCGCGCCCCTGACCAGCCGGGGCAGCCAGCAGTACCGGGCGCTCACGGTGCCCGAGCTCACCCAGCAGATGTTCGACTCCAAGAACATGATGGCCGCCTGCGACCCGCGCCACGGCCGCTACCTGACGGTGGCTGCCATCTTCCGGGGCCGCATGTCCATGAAGGAGGTGGACGAGCAGATGCTCAACGTGCAGAACAAGAACAGCAGCTACTTCGTGGAGTGGATCCCCAACAACGTGAAGACGGCCGTGTGCGACATCCCGCCCCGCGGCCTGAAGATGTCGGCCACCTTCATCGGCAACAGCACGGCCATCCAGGAGCTGTTCAAGCGCATCTCCGAGCAGTTCACGGCCATGTTCCGGCGCAAGGCCTTCCTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTGGTGTCCGAGTACCAGCAGTACCAGGACGCCACGGCCGACGAACAAGGGGAGTTCGAGGAGGAGGAGGGCGAGGACGAGGCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28661-Ab | Anti-TUBB2 monoclonal antibody |
Target Antigen | GM-Tg-g-T28661-Ag | TUBB2/TUBB2A protein |
ORF Viral Vector | pGMLP000050 | Human TUBB2A Lentivirus plasmid |
ORF Viral Vector | vGMLP000050 | Human TUBB2A Lentivirus particle |
Target information
Target ID | GM-T28661 |
Target Name | TUBB2 |
Gene ID | 7280, 22151, 109499596, 478701, 100295973, 100629875 |
Gene Symbol and Synonyms | CDCBM5,M(beta)2,TUBB,TUBB2,TUBB2A |
Uniprot Accession | Q13885 |
Uniprot Entry Name | TBB2A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000137267 |
Target Classification | Not Available |
Microtubules, key participants in processes such as mitosis and intracellular transport, are composed of heterodimers of alpha- and beta-tubulins. The protein encoded by this gene is a beta-tubulin. Defects in this gene are associated with complex cortical dysplasia with other brain malformations-5. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.