Human SDC4/SYND4 ORF/cDNA clone-Lentivirus plasmid (NM_002999)

Cat. No.: pGMLP000051
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SDC4/SYND4 Lentiviral expression plasmid for SDC4 lentivirus packaging, SDC4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SDC4/SYND4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $449.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000051
Gene Name SDC4
Accession Number NM_002999
Gene ID 6385
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 597 bp
Gene Alias SYND4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCCCGCCCGTCTGTTCGCGCTGCTGCTGTTCTTCGTAGGCGGAGTCGCCGAGTCGATCCGAGAGACTGAGGTCATCGACCCCCAGGACCTCCTAGAAGGCCGATACTTCTCCGGAGCCCTACCAGACGATGAGGATGTAGTGGGGCCCGGGCAGGAATCTGATGACTTTGAGCTGTCTGGCTCTGGAGATCTGGATGACTTGGAAGACTCCATGATCGGCCCTGAAGTTGTCCATCCCTTGGTGCCTCTAGATAACCATATCCCTGAGAGGGCAGGGTCTGGGAGCCAAGTCCCCACCGAACCCAAGAAACTAGAGGAGAATGAGGTTATCCCCAAGAGAATCTCACCCGTTGAAGAGAGTGAGGATGTGTCCAACAAGGTGTCAATGTCCAGCACTGTGCAGGGCAGCAACATCTTTGAGAGAACGGAGGTCCTGGCAGCTCTGATTGTGGGTGGCATCGTGGGCATCCTCTTTGCCGTCTTCCTGATCCTACTGCTCATGTACCGTATGAAGAAGAAGGATGAAGGCAGCTATGACCTGGGCAAGAAACCCATCTACAAGAAAGCCCCCACCAATGAGTTCTACGCGTGA
ORF Protein Sequence MAPARLFALLLFFVGGVAESIRETEVIDPQDLLEGRYFSGALPDDEDVVGPGQESDDFELSGSGDLDDLEDSMIGPEVVHPLVPLDNHIPERAGSGSQVPTEPKKLEENEVIPKRISPVEESEDVSNKVSMSSTVQGSNIFERTEVLAALIVGGIVGILFAVFLILLLMYRMKKKDEGSYDLGKKPIYKKAPTNEFYA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1493-Ab Anti-SDC4/ SYND4 monoclonal antibody
    Target Antigen GM-Tg-g-MP1493-Ag SDC4 VLP (virus-like particle)
    ORF Viral Vector pGMLP000051 Human SDC4 Lentivirus plasmid
    ORF Viral Vector vGMLP000051 Human SDC4 Lentivirus particle


    Target information

    Target ID GM-MP1493
    Target Name SDC4
    Gene ID 6385, 20971, 710914, 24771, 101090430, 485893, 508133, 100070934
    Gene Symbol and Synonyms RATRYUDOCA,RYUDOCA,ryudocan,S4,SDC4,SYND4,syndecan-4
    Uniprot Accession P31431
    Uniprot Entry Name SDC4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000124145
    Target Classification Not Available

    The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan that functions as a receptor in intracellular signaling. The encoded protein is found as a homodimer and is a member of the syndecan proteoglycan family. This gene is found on chromosome 20, while a pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.