Human CLPS ORF/cDNA clone-Lentivirus plasmid (NM_001832)

Cat. No.: pGMLP000077
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CLPS/ Lentiviral expression plasmid for CLPS lentivirus packaging, CLPS lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CLPS/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000077
Gene Name CLPS
Accession Number NM_001832
Gene ID 1208
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 339 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAAGATCCTGATCCTCCTGCTTGTCGCCCTCTCTGTGGCCTATGCAGCTCCTGGCCCCCGGGGGATCATTATCAACCTGGAGAACGGTGAGCTCTGCATGAATAGTGCCCAGTGTAAGAGCAATTGCTGCCAGCATTCAAGTGCGCTGGGCCTGGCCCGCTGCACATCCATGGCCAGCGAGAACAGCGAGTGCTCTGTCAAGACGCTCTATGGGATTTACTACAAGTGTCCCTGTGAGCGTGGCCTGACCTGTGAGGGAGACAAGACCATCGTGGGCTCCATCACCAACACCAACTTTGGCATCTGCCATGACGCTGGACGCTCCAAGCAGTGA
ORF Protein Sequence MEKILILLLVALSVAYAAPGPRGIIINLENGELCMNSAQCKSNCCQHSSALGLARCTSMASENSECSVKTLYGIYYKCPCERGLTCEGDKTIVGSITNTNFGICHDAGRSKQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0095-Ab Anti-COL/ CLPS functional antibody
    Target Antigen GM-Tg-g-SE0095-Ag CLPS protein
    ORF Viral Vector pGMLP000077 Human CLPS Lentivirus plasmid
    ORF Viral Vector vGMLP000077 Human CLPS Lentivirus particle


    Target information

    Target ID GM-SE0095
    Target Name CLPS
    Gene ID 1208, 109791, 719005, 25680, 101100391, 403970, 525923, 100053646
    Gene Symbol and Synonyms 2200003J09Rik,CLPS,CLPS1,CLPS2,COLQ
    Uniprot Accession P04118
    Uniprot Entry Name COL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000137392
    Target Classification Not Available

    The protein encoded by this gene is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilizing an active conformation and considerably increasing the overall hydrophobic binding site. The gene product allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. This cofactor is only expressed in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.