Human TNFAIP6/TSG-6/ TSG6 ORF/cDNA clone-Lentivirus plasmid (NM_007115)
Pre-made Human TNFAIP6/TSG-6/ TSG6 Lentiviral expression plasmid for TNFAIP6 lentivirus packaging, TNFAIP6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFAIP6/TSG-6 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000090 | Human TNFAIP6 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000090 |
Gene Name | TNFAIP6 |
Accession Number | NM_007115 |
Gene ID | 7130 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 834 bp |
Gene Alias | TSG-6, TSG6 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATCATCTTAATTTACTTATTTCTCTTGCTATGGGAAGACACTCAAGGATGGGGATTCAAGGATGGAATTTTTCATAACTCCATATGGCTTGAACGAGCAGCCGGTGTGTACCACAGAGAAGCACGGTCTGGCAAATACAAGCTCACCTACGCAGAAGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTGGCTGATTATGTTGAAATATATGACAGTTACGATGATGTCCATGGCTTTGTGGGAAGATACTGTGGAGATGAGCTTCCAGATGACATCATCAGTACAGGAAATGTCATGACCTTGAAGTTTCTAAGTGATGCTTCAGTGACAGCTGGAGGTTTCCAAATCAAATATGTTGCAATGGATCCTGTATCCAAATCCAGTCAAGGAAAAAATACAAGTACTACTTCTACTGGAAATAAAAACTTTTTAGCTGGAAGATTTAGCCACTTATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1343-Ab | Anti-TSG6/ TNFAIP6/ TSG-6 functional antibody |
Target Antigen | GM-Tg-g-SE1343-Ag | TNFAIP6 protein |
Cytokine | cks-Tg-g-GM-SE1343 | tumor necrosis factor, alpha-induced protein 6 (TNFAIP6) protein & antibody |
ORF Viral Vector | pGMLP000090 | Human TNFAIP6 Lentivirus plasmid |
ORF Viral Vector | vGMLP000090 | Human TNFAIP6 Lentivirus particle |
Target information
Target ID | GM-SE1343 |
Target Name | TNFAIP6 |
Gene ID | 7130, 21930, 694699, 84397, 101100655, 476147, 493710, 100034068 |
Gene Symbol and Synonyms | TNFAIP6,Tnfip6,TSG-6,TSG6 |
Uniprot Accession | P98066 |
Uniprot Entry Name | TSG6_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000123610 |
Target Classification | Not Available |
The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.