Human PA2G4/EBP1/HG4-1 ORF/cDNA clone-Lentivirus plasmid (NM_006191)

Cat. No.: pGMLP000102
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PA2G4/EBP1/HG4-1 Lentiviral expression plasmid for PA2G4 lentivirus packaging, PA2G4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PA2G4/EBP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $631.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000102
Gene Name PA2G4
Accession Number NM_006191
Gene ID 5036
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1185 bp
Gene Alias EBP1,HG4-1,p38-2G4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGGGCGAGGACGAGCAACAGGAGCAAACTATCGCTGAGGACCTGGTCGTGACCAAGTATAAGATGGGGGGCGACATCGCCAACAGGGTACTTCGGTCCTTGGTGGAAGCATCTAGCTCAGGTGTGTCGGTACTGAGCCTGTGTGAGAAAGGTGATGCCATGATTATGGAAGAAACAGGGAAAATCTTCAAGAAAGAAAAGGAAATGAAGAAAGGTATTGCTTTTCCCACCAGCATTTCGGTAAATAACTGTGTATGTCACTTCTCCCCTTTGAAGAGCGACCAGGATTATATTCTCAAGGAAGGTGACTTGGTAAAAATTGACCTTGGGGTCCATGTGGATGGCTTCATCGCTAATGTAGCTCACACTTTTGTGGTTGATGTAGCTCAGGGGACCCAAGTAACAGGGAGGAAAGCAGATGTTATTAAGGCAGCTCACCTTTGTGCTGAAGCTGCCCTACGCCTGGTCAAACCTGGAAATCAGAACACACAAGTGACAGAAGCCTGGAACAAAGTTGCCCACTCATTTAACTGCACGCCAATAGAAGGTATGCTGTCACACCAGTTGAAGCAGCATGTCATCGATGGAGAAAAAACCATTATCCAGAATCCCACAGACCAGCAGAAGAAGGACCATGAAAAAGCTGAATTTGAGGTACATGAAGTATATGCTGTGGATGTTCTCGTCAGCTCAGGAGAGGGCAAGGCCAAGGATGCAGGACAGAGAACCACTATTTACAAACGAGACCCCTCTAAACAGTATGGACTGAAAATGAAAACTTCACGTGCCTTCTTCAGTGAGGTGGAAAGGCGTTTTGATGCCATGCCGTTTACTTTAAGAGCATTTGAAGATGAGAAGAAGGCTCGGATGGGTGTGGTGGAGTGCGCCAAACATGAACTGCTGCAACCATTTAATGTTCTCTATGAGAAGGAGGGTGAATTTGTTGCCCAGTTTAAATTTACAGTTCTGCTCATGCCCAATGGCCCCATGCGGATAACCAGTGGTCCCTTCGAGCCTGACCTCTACAAGTCTGAGATGGAGGTCCAGGATGCAGAGCTAAAGGCCCTCCTCCAGAGTTCTGCAAGTCGAAAAACCCAGAAAAAGAAAAAAAAGAAGGCCTCCAAGACTGCAGAGAATGCCACCAGTGGGGAAACATTAGAAGAAAATGAAGCTGGGGACTGA
ORF Protein Sequence MSGEDEQQEQTIAEDLVVTKYKMGGDIANRVLRSLVEASSSGVSVLSLCEKGDAMIMEETGKIFKKEKEMKKGIAFPTSISVNNCVCHFSPLKSDQDYILKEGDLVKIDLGVHVDGFIANVAHTFVVDVAQGTQVTGRKADVIKAAHLCAEAALRLVKPGNQNTQVTEAWNKVAHSFNCTPIEGMLSHQLKQHVIDGEKTIIQNPTDQQKKDHEKAEFEVHEVYAVDVLVSSGEGKAKDAGQRTTIYKRDPSKQYGLKMKTSRAFFSEVERRFDAMPFTLRAFEDEKKARMGVVECAKHELLQPFNVLYEKEGEFVAQFKFTVLLMPNGPMRITSGPFEPDLYKSEMEVQDAELKALLQSSASRKTQKKKKKKASKTAENATSGETLEENEAGD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0394-Ab Anti-PA2G4/ EBP1/ HG4-1 functional antibody
    Target Antigen GM-Tg-g-SE0394-Ag PA2G4 protein
    ORF Viral Vector pGMLP000102 Human PA2G4 Lentivirus plasmid
    ORF Viral Vector vGMLP000102 Human PA2G4 Lentivirus particle


    Target information

    Target ID GM-SE0394
    Target Name PA2G4
    Gene ID 5036, 18813, 107000890, 288778, 101095110, 474396, 540272
    Gene Symbol and Synonyms 38kDa,EBP1,HG4-1,ITAF45,p38-2G4,PA2G4,Plfap
    Uniprot Accession Q9UQ80
    Uniprot Entry Name PA2G4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170515
    Target Classification Not Available

    This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.