Human CXCL14/BMAC/ BRAK ORF/cDNA clone-Lentivirus plasmid (NM_004887)

Pre-made Human CXCL14/BMAC/ BRAK Lentiviral expression plasmid for CXCL14 lentivirus packaging, CXCL14 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CXCL14/BMAC products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000121 Human CXCL14 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000121
Gene Name CXCL14
Accession Number NM_004887
Gene ID 9547
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 336 bp
Gene Alias BMAC, BRAK, KEC, KS1, MIP-2g, MIP2G, NJAC, SCYB14
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCCTGCTCCCACGCCGCGCCCCTCCGGTCAGCATGAGGCTCCTGGCGGCCGCGCTGCTCCTGCTGCTGCTGGCGCTGTACACCGCGCGTGTGGACGGGTCCAAATGCAAGTGCTCCCGGAAGGGACCCAAGATCCGCTACAGCGACGTGAAGAAGCTGGAAATGAAGCCAAAGTACCCGCACTGCGAGGAGAAGATGGTTATCATCACCACCAAGAGCGTGTCCAGGTACCGAGGTCAGGAGCACTGCCTGCACCCCAAGCTGCAGAGCACCAAGCGCTTCATCAAGTGGTACAACGCCTGGAACGAGAAGCGCAGGGTCTACGAAGAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0135-Ab Anti-CXL14/ CXCL14/ BMAC functional antibody
    Target Antigen GM-Tg-g-SE0135-Ag CXCL14 protein
    Cytokine cks-Tg-g-GM-SE0135 chemokine (C-X-C motif) ligand 14 (CXCL14) protein & antibody
    ORF Viral Vector pGMLP000121 Human CXCL14 Lentivirus plasmid
    ORF Viral Vector vGMLP000121 Human CXCL14 Lentivirus particle


    Target information

    Target ID GM-SE0135
    Target Name CXCL14
    Gene ID 9547, 57266, 712076, 306748, 101087962, 610078, 511771, 100072697
    Gene Symbol and Synonyms 1110031L23Rik,1200006I23Rik,BMAC,bolekine,BRAK,CXCL14,KEC,KS1,MIP-2g,MIP2G,MIP2gamma,NJAC,SCYB14
    Uniprot Accession O95715
    Uniprot Entry Name CXL14_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000145824
    Target Classification Not Available

    This antimicrobial gene belongs to the cytokine gene family which encode secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC (Cys-X-Cys) subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes but not for lymphocytes, dendritic cells, neutrophils or macrophages. It has been implicated that this cytokine is involved in the homeostasis of monocyte-derived macrophages rather than in inflammation. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.