Human GNAI2/GIP/GNAI2B ORF/cDNA clone-Lentivirus plasmid (NM_002070)

Cat. No.: pGMLP000132
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GNAI2/GIP/GNAI2B Lentiviral expression plasmid for GNAI2 lentivirus packaging, GNAI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GNAI2/GIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $599.04
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000132
Gene Name GNAI2
Accession Number NM_002070
Gene ID 2771
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1068 bp
Gene Alias GIP,GNAI2B,H_LUCA15.1,H_LUCA16.1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCTGCACCGTGAGCGCCGAGGACAAGGCGGCGGCCGAGCGCTCTAAGATGATCGACAAGAACCTGCGGGAGGACGGAGAGAAGGCGGCGCGGGAGGTGAAGTTGCTGCTGTTGGGTGCTGGGGAGTCAGGGAAGAGCACCATCGTCAAGCAGATGAAGATCATCCACGAGGATGGCTACTCCGAGGAGGAATGCCGGCAGTACCGGGCGGTTGTCTACAGCAACACCATCCAGTCCATCATGGCCATTGTCAAAGCCATGGGCAACCTGCAGATCGACTTTGCCGACCCCTCCAGAGCGGACGACGCCAGGCAGCTATTTGCACTGTCCTGCACCGCCGAGGAGCAAGGCGTGCTCCCTGATGACCTGTCCGGCGTCATCCGGAGGCTCTGGGCTGACCATGGTGTGCAGGCCTGCTTTGGCCGCTCAAGGGAATACCAGCTCAACGACTCAGCTGCCTACTACCTGAACGACCTGGAGCGTATTGCACAGAGTGACTACATCCCCACACAGCAAGATGTGCTACGGACCCGCGTAAAGACCACGGGGATCGTGGAGACACACTTCACCTTCAAGGACCTACACTTCAAGATGTTTGATGTGGGTGGTCAGCGGTCTGAGCGGAAGAAGTGGATCCACTGCTTTGAGGGCGTCACAGCCATCATCTTCTGCGTAGCCTTGAGCGCCTATGACTTGGTGCTAGCTGAGGACGAGGAGATGAACCGCATGCATGAGAGCATGAAGCTATTCGATAGCATCTGCAACAACAAGTGGTTCACAGACACGTCCATCATCCTCTTCCTCAACAAGAAGGACCTGTTTGAGGAGAAGATCACACACAGTCCCCTGACCATCTGCTTCCCTGAGTACACAGGGGCCAACAAATATGATGAGGCAGCCAGCTACATCCAGAGTAAGTTTGAGGACCTGAATAAGCGCAAAGACACCAAGGAGATCTACACGCACTTCACGTGCGCCACCGACACCAAGAACGTGCAGTTCGTGTTTGACGCCGTCACCGATGTCATCATCAAGAACAACCTGAAGGACTGCGGCCTCTTCTGA
ORF Protein Sequence MGCTVSAEDKAAAERSKMIDKNLREDGEKAAREVKLLLLGAGESGKSTIVKQMKIIHEDGYSEEECRQYRAVVYSNTIQSIMAIVKAMGNLQIDFADPSRADDARQLFALSCTAEEQGVLPDDLSGVIRRLWADHGVQACFGRSREYQLNDSAAYYLNDLERIAQSDYIPTQQDVLRTRVKTTGIVETHFTFKDLHFKMFDVGGQRSERKKWIHCFEGVTAIIFCVALSAYDLVLAEDEEMNRMHESMKLFDSICNNKWFTDTSIILFLNKKDLFEEKITHSPLTICFPEYTGANKYDEAASYIQSKFEDLNKRKDTKEIYTHFTCATDTKNVQFVFDAVTDVIIKNNLKDCGLF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2143-Ab Anti-GNAI2/ GIPB/ H_LUCA15.1 monoclonal antibody
    Target Antigen GM-Tg-g-MP2143-Ag GNAI2 VLP (virus-like particle)
    ORF Viral Vector pGMLP000132 Human GNAI2 Lentivirus plasmid
    ORF Viral Vector vGMLP000132 Human GNAI2 Lentivirus particle


    Target information

    Target ID GM-MP2143
    Target Name GNAI2
    Gene ID 2771, 14678, 703780, 81664, 101089679, 442957, 281791, 100062085
    Gene Symbol and Synonyms Galphai2,Gia,GIP,Gnai-2,GNAI2,GNAI2B,HG1C,H_LUCA15.1,H_LUCA16.1
    Uniprot Accession P04899
    Uniprot Entry Name GNAI2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000114353
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.