Human CD1B/CD1/CD1A ORF/cDNA clone-Lentivirus plasmid (NM_001764)

Cat. No.: pGMLP000159
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD1B/CD1/CD1A Lentiviral expression plasmid for CD1B lentivirus packaging, CD1B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CD1B/CD1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $580.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000159
Gene Name CD1B
Accession Number NM_001764
Gene ID 910
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1002 bp
Gene Alias CD1,CD1A,R1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTGCTGCCATTTCAACTGTTAGCTGTTCTCTTTCCTGGTGGTAACAGTGAACATGCCTTCCAGGGGCCGACCTCCTTTCATGTTATCCAGACCTCGTCCTTTACCAATAGTACCTGGGCACAAACTCAAGGCTCAGGCTGGTTGGATGATTTGCAGATTCATGGCTGGGATAGCGACTCAGGCACTGCCATATTCCTGAAGCCTTGGTCTAAAGGTAACTTTAGTGATAAGGAGGTTGCTGAGTTAGAGGAGATATTCCGAGTCTACATCTTTGGATTCGCTCGAGAAGTACAAGACTTTGCCGGTGATTTCCAGATGAAATACCCCTTTGAGATCCAGGGCATAGCAGGCTGTGAGCTACATTCTGGAGGTGCCATAGTAAGCTTCCTGAGGGGAGCTCTAGGAGGATTGGATTTCCTGAGTGTCAAGAATGCTTCATGTGTGCCTTCCCCAGAAGGTGGCAGCAGGGCACAGAAATTCTGTGCACTAATCATACAATATCAAGGTATCATGGAAACTGTGAGAATTCTCCTCTATGAAACCTGCCCCCGATATCTCTTGGGCGTCCTCAATGCAGGAAAAGCAGATCTGCAAAGACAAGTGAAGCCTGAGGCCTGGCTGTCCAGTGGCCCCAGTCCTGGACCTGGCCGTCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCTAGGGGACATCCTGCCCAATGCTAACTGGACATGGTATCTCCGAGCAACCCTGGATGTGGCAGATGGGGAGGCGGCTGGCCTGTCCTGTCGGGTGAAGCACAGCAGTTTAGAGGGCCAGGACATCATCCTCTACTGGAGAAACCCCACCTCCATTGGCTCAATTGTTTTGGCAATAATAGTGCCTTCCTTGCTCCTTTTGCTATGCCTTGCATTATGGTATATGAGGCGCCGGTCATATCAGAATATCCCATGA
ORF Protein Sequence MLLLPFQLLAVLFPGGNSEHAFQGPTSFHVIQTSSFTNSTWAQTQGSGWLDDLQIHGWDSDSGTAIFLKPWSKGNFSDKEVAELEEIFRVYIFGFAREVQDFAGDFQMKYPFEIQGIAGCELHSGGAIVSFLRGALGGLDFLSVKNASCVPSPEGGSRAQKFCALIIQYQGIMETVRILLYETCPRYLLGVLNAGKADLQRQVKPEAWLSSGPSPGPGRLQLVCHVSGFYPKPVWVMWMRGEQEQQGTQLGDILPNANWTWYLRATLDVADGEAAGLSCRVKHSSLEGQDIILYWRNPTSIGSIVLAIIVPSLLLLLCLALWYMRRRSYQNIP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0198-Ab Anti-CD1B/ CD1/ CD1A monoclonal antibody
    Target Antigen GM-Tg-g-MP0198-Ag CD1B VLP (virus-like particle)
    ORF Viral Vector pGMLP000159 Human CD1B Lentivirus plasmid
    ORF Viral Vector vGMLP000159 Human CD1B Lentivirus particle


    Target information

    Target ID GM-MP0198
    Target Name CD1B
    Gene ID 910, 718955
    Gene Symbol and Synonyms CD1,CD1A,CD1B,R1
    Uniprot Accession P29016
    Uniprot Entry Name CD1B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000158485
    Target Classification Not Available

    This gene encodes a member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.