Human CD3G/CD3-GAMMA/IMD17 ORF/cDNA clone-Lentivirus plasmid (NM_000073)

Cat. No.: pGMLP000197
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD3G/CD3-GAMMA/IMD17 Lentiviral expression plasmid for CD3G lentivirus packaging, CD3G lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD3G/CD3-GAMMA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $437.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000197
Gene Name CD3G
Accession Number NM_000073
Gene ID 917
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 549 bp
Gene Alias CD3-GAMMA,IMD17,T3G
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACTTTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAGATGATCGGCTTCCTAACTGAAGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGACCCTCGAGGGATGTATCAGTGTAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTATTACAGAATGTGTCAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTTGCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGATGGAGTTCGCCAGTCGAGAGCTTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTACCAGCCCCTCAAGGATCGAGAAGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGGAGGAATTGA
ORF Protein Sequence MEQGKGLAVLILAIILLQGTLAQSIKGNHLVKVYDYQEDGSVLLTCDAEAKNITWFKDGKMIGFLTEDKKKWNLGSNAKDPRGMYQCKGSQNKSKPLQVYYRMCQNCIELNAATISGFLFAEIVSIFVLAVGVYFIAGQDGVRQSRASDKQTLLPNDQLYQPLKDREDDQYSHLQGNQLRRN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T18972-Ab Anti-CD3G/ CD3-GAMMA/ IMD17 monoclonal antibody
    Target Antigen GM-Tg-g-T18972-Ag CD3G VLP (virus-like particle)
    ORF Viral Vector pGMLP000197 Human CD3G Lentivirus plasmid
    ORF Viral Vector vGMLP000197 Human CD3G Lentivirus particle


    Target information

    Target ID GM-T18972
    Target Name CD3G
    Gene ID 917, 12502, 705270, 300678, 101089292, 489383, 281055, 100062960
    Gene Symbol and Synonyms CD3-GAMMA,CD3G,CD3GAMMA,Ctg-3,Ctg3,IMD17,T3G
    Uniprot Accession P09693
    Uniprot Entry Name CD3G_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000160654
    Target Classification Not Available

    The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.