Human TOLLIP/IL-1RAcPIP ORF/cDNA clone-Lentivirus plasmid (NM_019009)
Cat. No.: pGMLP000225
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TOLLIP/IL-1RAcPIP Lentiviral expression plasmid for TOLLIP lentivirus packaging, TOLLIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TOLLIP/IL-1RAcPIP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000225 |
Gene Name | TOLLIP |
Accession Number | NM_019009 |
Gene ID | 54472 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 825 bp |
Gene Alias | IL-1RAcPIP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGACCACCGTCAGCACTCAGCGCGGGCCGGTGTACATCGGTGAGCTCCCGCAGGACTTCCTCCGCATCACGCCCACACAGCAGCAGCGGCAGGTCCAGCTGGACGCCCAGGCGGCCCAGCAGCTGCAGTACGGAGGCGCAGTGGGCACCGTGGGCCGACTGAACATCACGGTGGTACAGGCAAAGTTGGCCAAGAATTACGGCATGACCCGCATGGACCCCTACTGCCGACTGCGCCTGGGCTACGCGGTGTACGAGACGCCCACGGCACACAATGGCGCCAAGAATCCCCGCTGGAATAAGGTCATCCACTGCACGGTGCCCCCAGGCGTGGACTCTTTCTATCTCGAGATCTTCGATGAGAGAGCCTTCTCCATGGACGACCGCATTGCCTGGACCCACATCACCATCCCGGAGTCCCTGAGGCAGGGCAAGGTGGAGGACAAGTGGTACAGCCTGAGCGGGAGGCAGGGGGACGACAAGGAGGGCATGATCAACCTCGTCATGTCCTACGCGCTGCTTCCAGCTGCCATGGTGATGCCACCCCAGCCCGTGGTCCTGATGCCAACAGTGTACCAGCAGGGCGTTGGCTATGTGCCCATCACAGGGATGCCCGCTGTCTGTAGCCCCGGCATGGTGCCCGTGGCCCTGCCCCCGGCCGCCGTGAACGCCCAGCCCCGCTGTAGCGAGGAGGACCTGAAAGCCATCCAGGACATGTTCCCCAACATGGACCAGGAGGTGATCCGCTCCGTGCTGGAAGCCCAGCGAGGGAACAAGGATGCCGCCATCAACTCCCTGCTGCAGATGGGGGAGGAGCCATAG |
ORF Protein Sequence | MATTVSTQRGPVYIGELPQDFLRITPTQQQRQVQLDAQAAQQLQYGGAVGTVGRLNITVVQAKLAKNYGMTRMDPYCRLRLGYAVYETPTAHNGAKNPRWNKVIHCTVPPGVDSFYLEIFDERAFSMDDRIAWTHITIPESLRQGKVEDKWYSLSGRQGDDKEGMINLVMSYALLPAAMVMPPQPVVLMPTVYQQGVGYVPITGMPAVCSPGMVPVALPPAAVNAQPRCSEEDLKAIQDMFPNMDQEVIRSVLEAQRGNKDAAINSLLQMGEEP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0609-Ab | Anti-TOLIP/ TOLLIP/ IL-1RAcPIP functional antibody |
Target Antigen | GM-Tg-g-SE0609-Ag | TOLLIP protein |
ORF Viral Vector | pGMLP000225 | Human TOLLIP Lentivirus plasmid |
ORF Viral Vector | vGMLP000225 | Human TOLLIP Lentivirus particle |
Target information
Target ID | GM-SE0609 |
Target Name | TOLLIP |
Gene ID | 54472, 54473, 702587, 361677, 101095614, 483657, 539480, 100051383 |
Gene Symbol and Synonyms | 4930403G24Rik,4931428G15Rik,IL-1RAcPIP,TOLLIP |
Uniprot Accession | Q9H0E2 |
Uniprot Entry Name | TOLIP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000078902 |
Target Classification | Not Available |
This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.