Human TOLLIP/IL-1RAcPIP ORF/cDNA clone-Lentivirus particle (NM_019009)

Cat. No.: vGMLP000225

Pre-made Human TOLLIP/IL-1RAcPIP Lentiviral expression plasmid for TOLLIP lentivirus packaging, TOLLIP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TOLLIP/IL-1RAcPIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000225 Human TOLLIP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000225
Gene Name TOLLIP
Accession Number NM_019009
Gene ID 54472
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 825 bp
Gene Alias IL-1RAcPIP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGACCACCGTCAGCACTCAGCGCGGGCCGGTGTACATCGGTGAGCTCCCGCAGGACTTCCTCCGCATCACGCCCACACAGCAGCAGCGGCAGGTCCAGCTGGACGCCCAGGCGGCCCAGCAGCTGCAGTACGGAGGCGCAGTGGGCACCGTGGGCCGACTGAACATCACGGTGGTACAGGCAAAGTTGGCCAAGAATTACGGCATGACCCGCATGGACCCCTACTGCCGACTGCGCCTGGGCTACGCGGTGTACGAGACGCCCACGGCACACAATGGCGCCAAGAATCCCCGCTGGAATAAGGTCATCCACTGCACGGTGCCCCCAGGCGTGGACTCTTTCTATCTCGAGATCTTCGATGAGAGAGCCTTCTCCATGGACGACCGCATTGCCTGGACCCACATCACCATCCCGGAGTCCCTGAGGCAGGGCAAGGTGGAGGACAAGTGGTACAGCCTGAGCGGGAGGCAGGGGGACGACAAGGAGGGCATGATCAACCTCGTCATGTCCTACGCGCTGCTTCCAGCTGCCATGGTGATGCCACCCCAGCCCGTGGTCCTGATGCCAACAGTGTACCAGCAGGGCGTTGGCTATGTGCCCATCACAGGGATGCCCGCTGTCTGTAGCCCCGGCATGGTGCCCGTGGCCCTGCCCCCGGCCGCCGTGAACGCCCAGCCCCGCTGTAGCGAGGAGGACCTGAAAGCCATCCAGGACATGTTCCCCAACATGGACCAGGAGGTGATCCGCTCCGTGCTGGAAGCCCAGCGAGGGAACAAGGATGCCGCCATCAACTCCCTGCTGCAGATGGGGGAGGAGCCATAG
ORF Protein Sequence MATTVSTQRGPVYIGELPQDFLRITPTQQQRQVQLDAQAAQQLQYGGAVGTVGRLNITVVQAKLAKNYGMTRMDPYCRLRLGYAVYETPTAHNGAKNPRWNKVIHCTVPPGVDSFYLEIFDERAFSMDDRIAWTHITIPESLRQGKVEDKWYSLSGRQGDDKEGMINLVMSYALLPAAMVMPPQPVVLMPTVYQQGVGYVPITGMPAVCSPGMVPVALPPAAVNAQPRCSEEDLKAIQDMFPNMDQEVIRSVLEAQRGNKDAAINSLLQMGEEP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0609-Ab Anti-TOLIP/ TOLLIP/ IL-1RAcPIP functional antibody
    Target Antigen GM-Tg-g-SE0609-Ag TOLLIP protein
    ORF Viral Vector pGMLP000225 Human TOLLIP Lentivirus plasmid
    ORF Viral Vector vGMLP000225 Human TOLLIP Lentivirus particle


    Target information

    Target ID GM-SE0609
    Target Name TOLLIP
    Gene ID 54472, 54473, 702587, 361677, 101095614, 483657, 539480, 100051383
    Gene Symbol and Synonyms 4930403G24Rik,4931428G15Rik,IL-1RAcPIP,TOLLIP
    Uniprot Accession Q9H0E2
    Uniprot Entry Name TOLIP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000078902
    Target Classification Not Available

    This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.