Human STAR/STARD1 ORF/cDNA clone-Lentivirus plasmid (NM_000349)

Cat. No.: pGMLP000227
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human STAR/STARD1 Lentiviral expression plasmid for STAR lentivirus packaging, STAR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to STAR/STARD1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $514.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000227
Gene Name STAR
Accession Number NM_000349
Gene ID 6770
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 858 bp
Gene Alias STARD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTAGCGACATTCAAGCTGTGCGCTGGGAGCTCCTACAGACACATGCGCAACATGAAGGGGCTGAGGCAACAGGCTGTGATGGCCATCAGCCAGGAGCTGAACCGGAGGGCCCTGGGGGGCCCCACCCCTAGCACGTGGATTAACCAGGTTCGGCGGCGGAGCTCTCTACTCGGTTCTCGGCTGGAAGAGACTCTCTACAGTGACCAGGAGCTGGCCTATCTCCAGCAGGGGGAGGAGGCCATGCAGAAGGCCTTGGGCATCCTTAGCAACCAAGAGGGCTGGAAGAAGGAGAGTCAGCAGGACAATGGGGACAAAGTGATGAGTAAAGTGGTCCCAGATGTGGGCAAGGTGTTCCGGCTGGAGGTCGTGGTGGACCAGCCCATGGAGAGGCTCTATGAAGAGCTCGTGGAGCGCATGGAAGCAATGGGGGAGTGGAACCCCAATGTCAAGGAGATCAAGGTCCTGCAGAAGATCGGAAAAGATACATTCATTACTCACGAGCTGGCTGCCGAGGCAGCAGGAAACCTGGTGGGGCCCCGTGACTTTGTGAGCGTGCGCTGTGCCAAGCGCCGAGGCTCCACCTGTGTGCTGGCTGGCATGGCCACAGACTTCGGGAACATGCCTGAGCAGAAGGGTGTCATCAGGGCGGAGCACGGTCCCACTTGCATGGTGCTTCACCCGTTGGCTGGAAGTCCCTCTAAGACCAAACTTACGTGGCTACTCAGCATCGACCTCAAGGGGTGGCTGCCCAAGAGCATCATCAACCAGGTCCTGTCCCAGACCCAGGTGGATTTTGCCAACCACCTGCGCAAGCGCCTGGAGTCCCACCCTGCCTCTGAAGCCAGGTGTTGA
ORF Protein Sequence MLLATFKLCAGSSYRHMRNMKGLRQQAVMAISQELNRRALGGPTPSTWINQVRRRSSLLGSRLEETLYSDQELAYLQQGEEAMQKALGILSNQEGWKKESQQDNGDKVMSKVVPDVGKVFRLEVVVDQPMERLYEELVERMEAMGEWNPNVKEIKVLQKIGKDTFITHELAAEAAGNLVGPRDFVSVRCAKRRGSTCVLAGMATDFGNMPEQKGVIRAEHGPTCMVLHPLAGSPSKTKLTWLLSIDLKGWLPKSIINQVLSQTQVDFANHLRKRLESHPASEARC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33063-Ab Anti-STAR monoclonal antibody
    Target Antigen GM-Tg-g-T33063-Ag STAR protein
    ORF Viral Vector pGMLP000227 Human STAR Lentivirus plasmid
    ORF Viral Vector vGMLP000227 Human STAR Lentivirus particle


    Target information

    Target ID GM-T33063
    Target Name STAR
    Gene ID 6770, 20845, 699515, 25557, 100616071, 475588, 281507, 100009707
    Gene Symbol and Synonyms D8Ertd419e,STAR,STARD1
    Uniprot Accession P49675
    Uniprot Entry Name STAR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000147465
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.