Human STAR/STARD1 ORF/cDNA clone-Lentivirus particle (NM_000349)
Cat. No.: vGMLP000227
Pre-made Human STAR/STARD1 Lentiviral expression plasmid for STAR lentivirus packaging, STAR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
STAR/STARD1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000227 | Human STAR Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000227 |
| Gene Name | STAR |
| Accession Number | NM_000349 |
| Gene ID | 6770 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 858 bp |
| Gene Alias | STARD1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCTGCTAGCGACATTCAAGCTGTGCGCTGGGAGCTCCTACAGACACATGCGCAACATGAAGGGGCTGAGGCAACAGGCTGTGATGGCCATCAGCCAGGAGCTGAACCGGAGGGCCCTGGGGGGCCCCACCCCTAGCACGTGGATTAACCAGGTTCGGCGGCGGAGCTCTCTACTCGGTTCTCGGCTGGAAGAGACTCTCTACAGTGACCAGGAGCTGGCCTATCTCCAGCAGGGGGAGGAGGCCATGCAGAAGGCCTTGGGCATCCTTAGCAACCAAGAGGGCTGGAAGAAGGAGAGTCAGCAGGACAATGGGGACAAAGTGATGAGTAAAGTGGTCCCAGATGTGGGCAAGGTGTTCCGGCTGGAGGTCGTGGTGGACCAGCCCATGGAGAGGCTCTATGAAGAGCTCGTGGAGCGCATGGAAGCAATGGGGGAGTGGAACCCCAATGTCAAGGAGATCAAGGTCCTGCAGAAGATCGGAAAAGATACATTCATTACTCACGAGCTGGCTGCCGAGGCAGCAGGAAACCTGGTGGGGCCCCGTGACTTTGTGAGCGTGCGCTGTGCCAAGCGCCGAGGCTCCACCTGTGTGCTGGCTGGCATGGCCACAGACTTCGGGAACATGCCTGAGCAGAAGGGTGTCATCAGGGCGGAGCACGGTCCCACTTGCATGGTGCTTCACCCGTTGGCTGGAAGTCCCTCTAAGACCAAACTTACGTGGCTACTCAGCATCGACCTCAAGGGGTGGCTGCCCAAGAGCATCATCAACCAGGTCCTGTCCCAGACCCAGGTGGATTTTGCCAACCACCTGCGCAAGCGCCTGGAGTCCCACCCTGCCTCTGAAGCCAGGTGTTGA |
| ORF Protein Sequence | MLLATFKLCAGSSYRHMRNMKGLRQQAVMAISQELNRRALGGPTPSTWINQVRRRSSLLGSRLEETLYSDQELAYLQQGEEAMQKALGILSNQEGWKKESQQDNGDKVMSKVVPDVGKVFRLEVVVDQPMERLYEELVERMEAMGEWNPNVKEIKVLQKIGKDTFITHELAAEAAGNLVGPRDFVSVRCAKRRGSTCVLAGMATDFGNMPEQKGVIRAEHGPTCMVLHPLAGSPSKTKLTWLLSIDLKGWLPKSIINQVLSQTQVDFANHLRKRLESHPASEARC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T33063-Ab | Anti-STAR monoclonal antibody |
| Target Antigen | GM-Tg-g-T33063-Ag | STAR protein |
| ORF Viral Vector | pGMLP000227 | Human STAR Lentivirus plasmid |
| ORF Viral Vector | vGMLP000227 | Human STAR Lentivirus particle |
Target information
| Target ID | GM-T33063 |
| Target Name | STAR |
| Gene ID | 6770, 20845, 699515, 25557, 100616071, 475588, 281507, 100009707 |
| Gene Symbol and Synonyms | D8Ertd419e,STAR,STARD1 |
| Uniprot Accession | P49675 |
| Uniprot Entry Name | STAR_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000147465 |
| Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


