Human TUBA4A/ALS22/H2-ALPHA ORF/cDNA clone-Lentivirus plasmid (NM_006000)

Cat. No.: pGMLP000268
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TUBA4A/ALS22/H2-ALPHA Lentiviral expression plasmid for TUBA4A lentivirus packaging, TUBA4A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TUBA4A/ALS22 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $677.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000268
Gene Name TUBA4A
Accession Number NM_006000
Gene ID 7277
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1347 bp
Gene Alias ALS22,H2-ALPHA,TUBA1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGTGAATGCATCTCAGTCCACGTGGGGCAGGCAGGTGTCCAGATGGGCAATGCCTGCTGGGAGCTCTATTGCTTGGAACATGGGATTCAGCCTGATGGGCAGATGCCCAGTGACAAGACCATTGGTGGAGGGGACGACTCCTTCACCACCTTCTTCTGTGAAACTGGTGCTGGAAAACACGTACCCCGGGCAGTTTTTGTGGATCTGGAGCCTACGGTCATTGATGAGATCCGAAATGGCCCATACCGACAGCTCTTCCACCCAGAGCAGCTCATCACTGGGAAAGAGGATGCTGCCAACAACTATGCCCGTGGTCACTATACCATTGGCAAGGAGATCATTGACCCAGTGCTGGATCGGATCCGCAAGCTGTCTGACCAGTGCACAGGACTTCAGGGCTTCCTGGTGTTCCACAGCTTTGGTGGGGGCACTGGCTCTGGCTTCACCTCACTCCTGATGGAGCGGCTCTCTGTTGACTATGGCAAGAAATCCAAGCTGGAATTCTCCATCTACCCAGCCCCCCAGGTGTCTACAGCCGTGGTCGAGCCCTACAACTCTATCCTGACCACCCACACCACCCTGGAGCACTCAGACTGTGCCTTCATGGTGGACAACGAAGCAATCTATGACATCTGCCGCCGCAACCTAGACATCGAGCGCCCAACCTACACCAACCTCAATCGCCTCATTAGCCAAATTGTCTCCTCCATCACAGCTTCTCTGCGCTTTGACGGGGCCCTCAATGTGGACCTGACAGAGTTCCAGACCAACCTGGTGCCCTACCCTCGCATCCACTTCCCCCTGGCCACCTATGCACCAGTCATCTCTGCAGAAAAGGCATACCACGAGCAGCTGTCGGTGGCAGAGATCACCAATGCCTGCTTTGAGCCTGCCAACCAGATGGTAAAGTGTGATCCCCGGCACGGCAAGTACATGGCCTGCTGCCTGCTGTACCGTGGAGATGTGGTGCCCAAGGATGTCAACGCTGCCATTGCCGCCATCAAGACCAAGCGCAGCATTCAGTTTGTGGACTGGTGCCCCACAGGCTTCAAGGTTGGTATCAACTACCAGCCTCCCACTGTGGTGCCTGGGGGTGACCTGGCCAAGGTGCAGCGTGCCGTGTGCATGCTGAGCAACACGACCGCCATCGCCGAGGCCTGGGCCCGCCTGGACCACAAGTTCGACCTGATGTATGCCAAGAGGGCGTTTGTGCACTGGTATGTGGGTGAGGGCATGGAGGAGGGTGAGTTCTCCGAGGCCCGTGAGGATATGGCTGCCCTGGAGAAGGATTATGAGGAGGTGGGCATCGACTCCTATGAGGACGAGGATGAGGGAGAAGAATAA
ORF Protein Sequence MRECISVHVGQAGVQMGNACWELYCLEHGIQPDGQMPSDKTIGGGDDSFTTFFCETGAGKHVPRAVFVDLEPTVIDEIRNGPYRQLFHPEQLITGKEDAANNYARGHYTIGKEIIDPVLDRIRKLSDQCTGLQGFLVFHSFGGGTGSGFTSLLMERLSVDYGKKSKLEFSIYPAPQVSTAVVEPYNSILTTHTTLEHSDCAFMVDNEAIYDICRRNLDIERPTYTNLNRLISQIVSSITASLRFDGALNVDLTEFQTNLVPYPRIHFPLATYAPVISAEKAYHEQLSVAEITNACFEPANQMVKCDPRHGKYMACCLLYRGDVVPKDVNAAIAAIKTKRSIQFVDWCPTGFKVGINYQPPTVVPGGDLAKVQRAVCMLSNTTAIAEAWARLDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDMAALEKDYEEVGIDSYEDEDEGEE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0528-Ab Anti-TBA4A/ TUBA4A/ ALS22 functional antibody
    Target Antigen GM-Tg-g-SE0528-Ag TUBA4A protein
    ORF Viral Vector pGMLP000268 Human TUBA4A Lentivirus plasmid
    ORF Viral Vector vGMLP000268 Human TUBA4A Lentivirus particle


    Target information

    Target ID GM-SE0528
    Target Name TUBA4A
    Gene ID 7277, 702583, 316531, 101095277, 777775, 100059249
    Gene Symbol and Synonyms ALS22,H2-ALPHA,TUBA1,Tuba4,TUBA4A
    Uniprot Accession P68366
    Uniprot Entry Name TBA4A_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000127824
    Target Classification Not Available

    Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.